KEGG   Xanthomonas oryzae pv. oryzae PXO99A: PXO_03820Help
Entry
PXO_03820         gene      T00763                                 

Definition
(GenBank) pseudogene
Organism
xop  Xanthomonas oryzae pv. oryzae PXO99A
SSDB OrthologParalogGene clusterGFIT
Position
423495..424376
Genome map
NT seq 882 nt NT seq  +upstreamnt  +downstreamnt
ttgcccatgcatttgctgctgtttgccgttgtctgcagtgtcctggtgtcggtgctgttg
aagcttgcgccgcgccgccagatcgacgtgtttcaggccattacctggaactaggccacc
gccgcactgctggcgtggctgacgctgcaccctgcgttggacacgctacgtgctacgacc
acgccgtggttggcgctgctgctgttggccgtcgcattgccctccatcttcctggtgatg
gcgcggtcggtcgcggtcgcgggcattgtgcgtcccgatattgcgcagcgcttgtcgttg
gtgctctcgctcgccgccgccttcaccgtcttcggcgaaccggtcgatggctggaagctg
acgggtctggcactgggcctgttggcaatcgtgtgtatcgtgcgacgaccgcgtcaccaa
gacgccgcagatccgacaccggtgacaattggccggccctggctggttggcgtctggagc
ggttttgcgctcattgacttgctgctcaagcacattgcgcaggccgggacaccatcgctg
acatcgttgacgttgtgtttcgcgctggccttcctgctgatgcttggcgtgtagagcatg
cgggcggcacgtggcgcaaggctgaacatccgcagcatccttgccggcgtgctgttgggt
gcgctcaatttcggcaacatcctctcttacgtgcgcgcacaccagcgactgccgcacagc
ccggcgatcgtgtttgccagcatgaatctgggcgtggtcgtagtgggtgccctggtcggc
aggctgggagttgccgaacgcttgggtctgcgcggctggttggggctggcactggcggcc
cccgcgatcgctgcgatcgcatgggggatgcgtctggcttga

DBGET integrated database retrieval system