KEGG   Yersinia pestis CO92 (biovar Orientalis): YPO3604Help
Entry
YPO3604           gene      T00063                                 

Definition
(RefSeq) pseudogene
Organism
ype  Yersinia pestis CO92 (biovar Orientalis)
SSDB OrthologParalogGene clusterGFIT
Other DBs
NCBI-GeneID: 1176424
Position
4016048..4017360
Genome map
NT seq 1313 nt NT seq  +upstreamnt  +downstreamnt
atgagtgacaccccgcaacatatcatcattaaaaccggcactgacccacggaaccggccg
gaatttaacgccattcgtgaagagatcaacaaaatcaaccacccggcacggccagaggtc
aactggggtttgattgaatcactggcgctgaccctgttccgcacccacggcgtggatttg
cagacggcggtgtattacacgctggcccgcacccaaaaaaatggcctggccggtttcacc
gagggctgcgagttgctggccggtatggtagtcggccagtgggatcacctgtggccggaa
cagccgcaggcacgcagtgaaatactggaatggttcaatacccgcgtcagcaatcaactg
cgtcagcatgattttacccgtgacgatctgcggctggtgtaccgcgccgagcgggccttg
cagttgctgtacgataaattgcaacaggttgaattaaaacgggtaccgcgcattgaaaac
ttgctgtacctgatgcagaacaccgccaaaaaactcgaatcggccagtgatgcggcgaag
gctcagcaaaccgcggccccgctgaaaatgccgcctatggtctatctctcggtacccgag
gccgagcctgtccggacggcagcggcagcccctgagcctgcggccaatattgaggtgcgt
tcgcccccccggcgactaaacggggggcggtgctgtggggctttggtgccggtgtcctgt
gtagtttactggtggcgactgcggtttacgttacccagttcaaaccgctgcaacagcaaa
tgacggtgctggccacccaaccggaaagcgcggcattgctgtggctcaaccgcccggatg
tcgccacctatggtgagcaactgagcaccctggaaaacctctcgcccctgtttgtgctca
ataccgccgaccagtcggtggcgatggctcgtcaacgctggccgtccgatcccagtcagg
tggccgaaagccagcgctgggcgcggttggtggaggcgcgtatcggcctggccggtaccg
acagcagctatttccagctccagcagcgcttgcatgcgctgtctgaaaaattactcgaac
aggaacgttctcggggcagtctgaccatctcctatctaaaaacagcagtttaccagatgc
agaccgagctgaaccgggagataccgctggaggagttactgcgccagttggcggtgtccg
ccgatgaacatcaaccggcctcgccggtcttgataaaacaaattgatgaccgctggaatg
ccttactcagccgttatcaccacttaacgcagcagacgaactctgcccgttaa

DBGET integrated database retrieval system