GenomeNet

>rs:NC_005283 [NC_005283] Dolphin morbillivirus, complete genome.
accagacaaagctggctaggggtagaataacagataatgataaattatcatacttaggat
taatgatcctatcaattggcacaggatttggataaaggttcacagtcatggcgacacttc
ttcggagtctagctctgttcaagaggaacaaagatagaacacccctaattgcaggttcag
gaggagccataagagggattaagcatgttatcgtagtcccagtacccggtgattcatcga
ttgtcactaggtcaagattattggacaggttagtaagacttgctggtgacccttatataa
gtggacctaagctgacaggcgtcatgatcagtatactatcattgtttgttgaatcaccca
gtcaactaatacagcgaatcactgacgacccagatgtcagcatcagattagttgaagtaa
tccaaagtgagaagtccctatcagggctcacttttgcatccagaggcgctaatatggagg
atgaggcggatgactatttctctattcaagcaggggaggaaggggacaccagaggaaccc
attggtttgagaacaaagagatagttgaaattgaggttcaagacccagaagaattcaaca
tactattggcatctattcttgcacaaatttggatcctattagccaaggcagtcactgctc
cagatactgcagctgactccgagacgaggcggtggattaaatatactcagcaacgccgtg
tagtgggtgagtttcggcttgacaagggatggttggatgctgtgagaaatcggattgcgg
aggacctatcgttgaggagattcatggtggcattaattttagatatcaagagaacaccag
ggaacaaacccaggattgccgagatgatatgcgacatagacacctatatcgtcgaggcag
gtcttgctagcttcatcctaactatcaaattcgggatcgaaacaatgtacccggccttag
ggttgcatgaattctcgggtgaattaactacagttgagtctctaatgaacctctaccaac
agatgggcgagactgcaccgtacatggtaattcttgaaaactcaattcagaacaagttca
gtgcaggttcatacccgctattatggagctatgcaatgggagttggagttgaacttgaaa
attcaatgggtggacttaattttggtcgttcttacttcgaccctgcatatttcagactgg
gtcaagagatggtcaggagatcagcaggcaaggtgagctcatcgctagccgcagaactag
ggatcacagccgaggacgccaaacttgtctccgagattgctgcgcaggctaatgacgaca
gagctaatagagcaataggtcccaaacaaaaccagatatcgtttcttcatcctgacagag
gcgatgccagtactccagggaacatccttcgcgcaaacgagggtgacgggtccacccgga
tgaaaagaggggggaacattgctacaccaaaagggacaagcatagatcagacatcaacga
ctctcagcaaagacactctagacattgatgaacagtccgacaacactgacgacccaatta
gtatccaaaaatcagctgaggcattagccaagatgagagccatggccaagctattggaaa
accaaggcccgcgtgatgtcactgcgcacgtttataatgataaagatctacttggctgaa
caaaaggatccactctgagcagcgtcagactttgtattttcatcaatattacaaaaaact
taggaccaaagtccaaggaattgacctccacatcatttcatccaccgacaccatccccaa
atggcagaggagcaggcctatcatgtcaataagggacttgagtgtctcaaatctctcaga
gaaaatccgcccgatgctgtcgaaattaaggaagcccaaattatccgaagcaaggccgcc
tgcgaagaatcaagcgagagtcatcaccaggacaactccgaaaaagacactcttgatttc
gacgaatcatgctcttcagcaattagaccagaaacgtaccgcatgttacttggtgatgat
acaggatttagagcaccaggttacatccctaatgaaggagagcccgagccaggagacatc
ggaaaggaggaacctgcagtacgatgttaccatgtttatgatcacggcggtcaagcggtt
gaaggagtcaaggatgctgacctgctcgtggttccaacaggcagtgatgatgatgcagaa
ttcagagacggagatgagagctctctcgagagcgatggtgaatctggcactgttgatacc
agaggaaattcttcctctaacaggggatctgctcccaggattaaggtcgagagatcgtct
gacgttgagactataagcagtgaagagctacaaggactgattagatctcagagtcaaaaa
cataatggatttggagtagacagattcctaaaggtcccaccaattccaacctcagtgccg
ctggaccccgctcccaaatccattaaaaagggcacaggagagagatcagccttatctggg
acggagaccgagttttcattgacaggtggtgcaacccgacttgctcaagaatcaagatgg
gcatcgtcagagtcaagtgcacctgcggagaatgtccgccagtctgtgacgaatgcagag
aggacccagaaacccccacaaggatctggtaccacagcctcccagaaatcccagaacaat
ggccattctgatgatgagtatgaagatgaactctttatggaggtacaggagattaaaaca
gcaattacaaagattaatgaagataatcagcagataatatcaaaattggactctataatg
ctactaaagggtgaaattgaatctatcaagaaacagatcaataagcaaaatatcactata
tcaactatcgaaggccacctgtccagcataatgatagcaattccaggattcggtaaagat
cccaatgatcctactgcagacgtagaactcaatcccgatctgagacccataattagccgt
gatgcaggaagagctctagctgaggtcctcaagaggccagcagtcgagagaaatccaaag
gtcaccccaaaggtccatccaggatccaaggggcagattctgagggatctgcaacttaag
ccggtagacaggaaaatgagctctgctgtgggatttgtcccaactgatgatctgccgtct
cggagtgtgcttcgctccatgattaagtccagcaatcttgaatcagaacacaaacgaagc
atgatagggctcttgaatgatgtcaaaagtggcaaggatcttggagaattttatcagatg
gtgaaaaaaatcatcaagtaacataccaacctacatcttattgcttgcttgcctagctta
gtagtaatgttagtcaaaatgatcaattataaaaaacttaggattcaagactaagttgac
taccgtcgaaaatgaccgaggtttacgactttgatagatcagcctgggatgtcaaggggt
ctattgctcccatagagcccactacttatcccgatggaagactgatccctcaagttagag
ttatagatccaggcttaggtgacagaaaggatgagtgtttcatgtatatcttccttctgg
gcatattagaggataatgatataatgagccccccaatcgggaggactttcggctcactcc
cgctcggagtaggacgatcgactgctaaacctgaagaactgcttaaagaggccaccgaat
tggatattgtggtaaggaggacagcggggttaaatgagaaactagtcttctacaacaata
caccgcttatgttattgactccgtggaagaaagtacttactgctggaagtgtctttagtg
caaaccaagtctgcaatgctgtcaatcttatcccacttgacactccgcaaaggttcagag
ttgtctatatgagtataaccagactctcagacaatggatgctatagggttcccagaaaga
tgctggagttcagatctgctaatgctctggcattcaatatattagtgaccatcagaattg
aaaacgccggaattgtaagccgcccatacatgagcatgatgagagacccacaggcgactt
tcatgatccatattgggaacttccgcagaaagaagaatgaggcttactctgcagattact
gcaagatgaagatagaaaaaatgggcctcgtctttgctcttggcggaatcggagggacca
gcctacatatcagatgtactgggaagatgagtaagactctacatgctcagttagggttta
agaaaatactctgttaccccttaatggatgtcaacgaagaccttaataggtacttgtggc
gtgcagaatgcaagattgtgagaatccaagctgttcttcagccatcagtcccgcaggaat
tcagagtttatgatgatgttattatcaatgatgatcaagggttattcaagattctttaaa
aagctaaagaataagacttctcatttcaggctcatagctagttcatccagcagaatcaac
agagcttatatatattggataaatcagttcaaagctcaatgtagttggagtttgttgtag
ggttagtattgagagataatggaagtcctgataaaattcaccattcagctaatcaatggt
agataattatctgcatgcgcacatagaagcttagagtcttgcttctcatcctgattcttg
ataattccagcagaacaaagcttcaaacaacactgtactcagtttcgaattacctgatca
accacagatcctctcctcgacaatcaggggttaaacagtcctacatccagtgaccccaaa
agccaagacgtgacatcactcgcaaccaactgatgcaaattattaaataaaacttaggag
taaagtaattaagactccaagcaacacccgacaacccactacacccaaaaacagacaacg
acaaccggcagaacaaacagatctcgcataggcaaagagaccacaccacaattcctcctt
tgcaatcgaccacaccagccccaggctccatctccaggaccaccagtcatccattggctg
caaaaaacaggctcgatcagcatagggcaagccgatattcttgctatccccaatccagat
ccggttgatgcgctcctgaccaatcaccgcgagcgaccaagaatccagagctctcgatct
tgaagacaacttttcatctggtcgtcaacattgagtcactgtcgctaggagaaaatccgt
agtcaaatattgtcgaaaaggtagcacttatccttaggaccccagtactctcattcatgg
ccgctagtaacggcggtgttatgtatcagtcatttctcacaatcataatccttgtcatta
tgactgaagggcaaatccattgggggaatctctccaaaattgggatagttgggacaggaa
gtgccagctataaagtgatgaccaggcctaaccatcagtatctagttatcaaattgatgc
cgaatgtaactatgattgacaattgcacaagaactgaagtgacagagtacaggaaactac
ttaagacagtattagaaccggtcaagaacgctcttacagtgataacaaagaatattaagc
ctatacagtctttaaccaccagtagaaggagcaagaggtttgcaggagtggtcttggcag
gtgtggcattgggagttgctactgccgcccagataactgcaggagttgcccttcatcagt
ccatcatgaactcccagtcaattgataatctaagaacaagtttagaaaagtccaaccaag
ccatagaagagattagacaagcatcccaagaaactgtcttagctgttcaaggggtccaag
acttcatcaacaatgaactgattccatctatgcaccagctgtcttgcgagatgctaggac
agaaattgggtctaaaactattaaggtattacacagagatattgtccattttcggaccta
gcctcagagatcctgtctctgccgaaatatctattcaagcactgagttatgctcttggag
gagatattaacaaaatcttagaaaagttaggctatagtggtgcagatttacttgcaatac
tagagagtcgagggataaaagcaaaagttacccatgttgatttagaaggttactttatag
tactgagtattgcatacccgactctatcagaggtcaagggggtgatagtacacaaattgg
aggcagtttcctacaacttaggatctcaagagtggtacacaacattacccaaatatgtgg
cgaccaatggctatctaatctctaattttgatgaatcttcgtgtgcatttatgtcagaag
tgactatttgtagtcaaaatgcactttaccccatgagtccgttgctccaacaatgtctta
gaggatctaccgcatcatgcgcgcgaagcttagtatctgggacaattgggaatcgattca
tattatccaaagggaacttaatcgctaactgcgcatcggtactctgcaaatgttactcta
ctggcaccataattagccaggatccagataaactcttaacattcgtcgccgcagacaaat
gccctttagttgaggtagacggaatcacaatccaagtgggatccagggagtatcctgatt
cagtttatgtcagtagaattgatctcggcccagctatatcactggagaagttagatgtag
gcacaaatctgggcagtgccctgacaaaactggacaatgctaaagatctactagactcat
cgaatcaaattctagagaatgtcaggagaagttcctttggaggagcaatgtacataggga
tccttgtatgtgcaggagctttagtgattctgtgcgtattggtatactgttgtaggaggc
actgtcgcaaacgtgtccaaacaccccctaaagcaactcccggattaaagcctgatctaa
caggtactaccaaatcatatgtaagatccttgtgattttaatagttgcatgatggacatt
ccgtaacaccaaaacctaggcaaatatacaaatactggattattggtcatacctgagcca
ttatatatacaatatagagagtctaataaataaataattaaagaaaacttagggtgcaag
ttgaccaaccatgtcttctccgcgtgacaaggtcgacgcattctacaaggacataccaag
acctagaaacaatagggttttgctagacaatgagagggttatcatagaaagaccgttgat
actcgtgggtgtgctagccgttatgtttcttagtctggtaggactacttgccattgcagg
agttagactgcaaaaagcaacgactaacagcattgaggtgaacagaaaacttagcacaaa
tttggaaacaaccgtgtctattgaacatcatgttaaggatgtcttaactcctttgtttaa
gatcatcggagacgaagtggggttacggatgccccagaagttaacagagataatgcagtt
catatcaaacaagatcaaattcctcaacccagatagagaatacgacttcaatgatctaca
ctggtgtgttaacccccctgatcaagtcaaaattgactatgctcagtactgcaaccacat
cgcagccgaggagcttatagttactaagttcaaagagttaatgaaccactctctagatat
gagtaaaggaaggatattccctcctaagaattgctcgggctcagtcatcaccagaggtca
aactataaaaccagggctcaccttggttaacatatatacaacaaggaacttcgaagtctc
ctttatggtcacagtaatatctggggggatgtatgggaaaacatattttttgaaaccacc
cgaacctgatgatccatttgagttccaagcatttaggatctttgaggtaggattagtcag
agacgtagggagccgtgaacccgtgctgcagatgacaaatttcatggtgattgatgagga
cgaaggtctgaatttttgtttgttgtcagtcggagaacttagacttgcggctgtctgcgt
cagagggagaccagttgttacaaaggacataggaggttacaaagatgagccctttaaagt
tgttacgttgggcatcatagggggtggtttgagtaatcagaaaactgagatctacccgac
gattgattcttctatcgagaagttatacataacttctcatagaggtataatccgaaactc
aaaagctaggtggtcagtacctgcaattagaagtgatgacaaagacaaaatggagaaatg
cactcaagcattgtgcaagagtagaccacccccctcatgcaatagttctgattgggagcc
attgacgagcaaccggatcccagcttatgcatatattgcactagagattaaagaggactc
aggtctagagcttgatattacgtcaaactacggacccttgataatccatggagcagggat
ggacatttacgaaggccccagtagcaatcaagactggctggccattcctcctttgtcaca
atcagtactcggtgtcattaacaaggtcgattttacagcaggatttgatatcaaaccaca
tacccttacaactgcagtcgattacgagagtggaaaatgctatgtcccggttgagttgtc
aggagccaaggatcaggaccttaaattagaatcaaaccttgttgtattgcctacaaagga
ctttggttatgttacagcaacatatgacacctcaagaagtgagcatgcaatagtttatta
tgtgtatgacacagctaggtcttcatcatatttcttcccattcagaatcaaggcaagagg
agagccaatttatctgaggatagagtgtttcccctggtccaggcaactctggtgtcatca
ctactgcatgattaatagtacagtatccaatgagattgtagtggttgataacctagtaag
tatcaatatgagctgcagccgttagatgaacgactgttgagcctccaccaactgtcccag
tatgccgcaccatcagcactcccactctccaatccatcctctaatcagtggtcgctctag
accccattaagaaaaacttagggaccaggattattgcagagatggagtccatctcaatca
accagatcctataccctgaagtgcacctggatagtcctatagtcactaataagttagtag
ctatactggagtactctcgggtaacccatgggtacattctggaggatcagacattgacaa
agaatattcgctatagggtcgagaatggttactccaatcaaatgattataaataacctcg
aaattgggaatgtggtaaatctaagactcatgagttacccctaccacaggcacaagatct
accccgactgtaattatgacctattccatatttctgatcatcaaatttcttccaggctgt
taaccctattcaaaaagggaaatacaatatatactaagatcagcggaaaaattattgaat
gtatgaagggagtgaattcaaggctagggataagcagtgatttaagtaaagaagttacga
cagggatcacagatttgggagcctacatgcagagttctcaatggtatgggccttttctat
attggttcacaattaaaactgagatgcggtccatcatcaaatcagctacacacacaagtc
atagacataggatagtaccttcatttgtgcatggtgagagatgtgaagttttgatatcta
gagacttggtaaccataattaataaaaggtcacaagatatctactatctcacatttgaaa
tggtacttatgtactgcgatgtagtggaaggaaggttaatgacggaaactgcaatgactg
tggaccctaggtacactgagctcctctgtagagtaaagtacctatggaatttgatagacg
gcttcttccccaccttaggcaactccacatatcaaatcgtggcattattagagccattgt
ctctggcctatctccagttgaaagatatcacacttgaattgaggggcgcattccttagtc
actgttttaatgaaatccatgacattttggagagtagtggagttttaactgaggagacat
attctgatgttgtcaatgcattggattacatcttcattactgacgacatccacctgacag
gggagatattttcattcttccgaagtttcggtcacccgcgtcttgaagctgtaacagcag
ccaacaatgtgagaaagtatatgaaccaaccaaaagttatcaactacgagactatgatga
agggtcatgctatattttgtggtattatcattaatgggtaccgtgataggcacggaggta
gttggcctccgatttcccttccgactcatgcatcttcaatagttaggaatgccctggctt
caggtgagggattgacctacagtcaatgtattgataattggaggtcatttgctggggtta
agtttgggtgtttcatgcccttgagcctagatagtgacctgactatgtatctcaaggata
aagcactagcagcactcaagaaagaatgggattcggcttacccaaaggaataccttcgtt
ataatcctcccaagccgacaggatcgagaagactggtcaatgtttttcttgatgactcta
catttgatccttacaatatgatcctctacgtgataaatggctcctatttggaagaccctg
atttcaacttatcttacagcctaaaagaaaaagagattaaagaagttgggagactatttg
ccaaaatgacctaccaaatgagggcttgccaagtcattgcagagaatttaatatcaaatg
gaatagggaagtatttcaaagacaacggtatggccaaagatgaacatgatcttacaaagg
cactccacacactagcggtttcaggtatacctaagaacaaaaaagattaccatagaggtg
aaggtgggagacagaccaatccttggtggtttggtgacaagtcaaagattaataagcgac
atggacaaacctcaacggctcattctaattatgctggtgccgggtgcggaatcaagaatg
gacatgatcaggaggcttacgagactgtcagtgcttttatcacgactgatcttaagaaat
actgtttaaattggaggtatgagacaatcagcatatttgcccagagactaaatgagattt
atgggttgccttcattcttccagtggctacacaagaggttggagaaatcagtcctatatg
taagcgatcctcactgtccaccagatcttgatactcatatggatttagatgccgtcccaa
actctcaaatatttataaagtacccaatgggagggatcgaaggatactgtcagaagctct
ggacaataagtacaataccctacctgtacctagcggctcatgagagtggagttaggattg
cctcattggttcaaggagacaaccagaccatagccgtcacaaaaagagtcccaagcacct
ggccctatgatctcaagaagagggaggctacaaaaataactattgagtacttcttaatcc
taaggcagcgattgcacgatatagggcatcatttgaaagcaaatgaaacaattatatcct
cacatttctttgtttactcaaaaggtatatattatgatggaatgctgatctctcaatcac
ttaaaagtgtggctcggtgtgttttctggtcggaaacaattgtggatgaaactagagcag
cttgcagtaatatctcgacaactcttgcaaaaagcatagaaaggggatttgaccggtatt
tggcttactcattgaatgtactcaagattattcaacagatccttatctccctagggttta
caataaacacttctatgactcaagacatagcaatcccattactgcagaatcaagatttgt
tgattaagatggcactactacctgctcctataggtggcctcaattatcttaatatgagca
gattattcgtaaggaatataggtgatccagttacgtcctctttagctgacctcaaaagaa
tgataattgcagggattatgcctgaggagtcgatccaccaagttatgacacaacaaccag
gggattcctctttcctagattgggcgagtgatccctactcagctaatctaccatgtgtcc
agagtatcactcggctgcttaagaatataactgcgaggcatgtactaataaatagtccca
atccgatgttaagggggttattccatgcggatagccatgaggtagatgagagtttagcaa
cttttctcatggatagacacatcatcagacctagagcagctcatgagattctcgacaaca
gcatcgcagtggctcgcgaatcacttgcagggatgctcgatactactaaagggctaataa
gggctagtatgaaaagaggtggactgaccccacgaatcatcacgagattatcaaattatg
attatgatcagtctaaaatgggaatatcacttttaactgtgaagaaacggaacaatctta
tcgatagggagtcttgctcagtccagctggcccgagccctcagaagtcacatgtgggcga
aactcgcaagaggaaggtcgatatacggacttgaggttcctgttgtactagaatcaatga
aagggtacattattaaacgtcatgagtcttgttcattatgtgaaactggctcactgaatt
atggttggttctttggtcccgccaattgccaattagataatatttccaaggagacatcat
ctttacgagttccctatattgggtcaacaacagaggaaaggacagacatgaaattagcat
ttgccaagtcccctagtcgctccctcaaatctgccgtgagaattgctacagtgtactctt
gggcttatggtgatgacgaccagtcatggcatgaggcatggactctagcgaggcagagag
ctaacattaccttagaggagttaaggatgattaccccaatatcgacatccaccaatttgg
ctcatcgattgagggatcgtaacactcaggtaaagtactcaggtacatcgttaatccgag
tagcgaggtatacaacaatatcgaatgataacttatcattcattatagcagataagaagg
tggatacaaatttcatttatcagcaaggaatgttgttgggattgggaatcctagaaacat
atttcaggttacagacaaatacggggtcctctaatacagtgttacatctacatgttgaag
cagaatgctgtgtaatccctatgactgaccatcccagagtcccaagtcaccgtactgcac
ctagcgccaggaaaatgtgcaccaatccattgatctacgataattctccaatcattgaga
aggatgcggtacgtctatattcccagagccatagaaagcacctcgtggagtttgttactt
ggtcaacggggcagctgtatcacgtactagcgaaatcaactgctatgtcaatgatcgaat
tggttaccaaatttgagaaagatcatctgaacgaaatagctgctttaataggagacgatg
atatcaatagtttcatcactgaattccttctagtagagcctagactatttacagtatact
taggccaatgtgcagctattaattgggctttcgagatacattatcaccgtccttcaggca
agtaccaaatgggagagttgctcttttcttttttgtgtaggatgagtaaaggtgttttta
aaatccttactaatgctttgagtcatcctaaagtctacaggagattttgggactgtggaa
taattgagccaatacacggcccctctctagatactcaaaatttacatctcacggtctgta
acatgatctaccactgttatatgatatatctagatttgctcttgaatgatgagcttgatg
atttcactttcctattgtgcgagagtgatgaagatgtagtcagtgaccggtttgagaata
tccaagcaaggtacctttgtattcttgcagatctgtactgtaatgcaaaaaactgcccgt
caataagggagcttgcacctataaagaagtgtgcagtacttacacaattcattaaatcgg
aagcattaatttctcctggggggttggattggaatgatgaaccgatagtagtagaccact
tttcttgctccttaacatatctcagaagaggggcggttaaacagatcaggctgagggttg
atcctgggttcgtatcggaagttctaattgacgcttctgaccataacctgggaccaatta
aagctaaggagattaaattagatagcataaatttctatccccccaaggaagatgttgcac
gattactcagtactataggcacagcccagcatgatctccccataatcggtactagagtaa
tcaactatgaagtacacgcttacaggagaatagggttgaactcatctgcttgctacaagg
cagtagaagtatcctcggtaatcaagagcatgattgaaccaggagaggatgggttattct
tgggtgaaggttcaggttctatgctagtcacgtatagggaaatactcaagcttaaacgtt
gttattacaacagaggagtgtcagtcgagtctagatctgggcaaagagagatatctccct
atccatcagaagttagtcttgttgaacaccaactagggctggatcgtagtgttaaggtat
tattcaacgggaaaccagaggtgacatgggtaggtaatgtagattgttataagtatatca
ttagtaatataccatcttcaagtctgggactaatccactcagatatcgagaccttaccaa
ataaggacctagttgaaaagctggaagaattaactgccatattgtcgatgacatttattt
taggtaaaataggatctctcctaataatcaagataatgccgacaagcggggacttagttc
aaggattcatcggatacaccactcctttttttagagagagcattattgtataccctagat
acagtaactttatctccactgagtgttatctagtatttgttgggcttaagtacaatagat
taatcaaccctgaaggaataaaacaacaactactaaaattgagcataagaacatcaccgg
gatttgtagcacatttgttatctatgaagcaagcaaactacctacaatcccttattggac
tccctgttcagaaaggattctttaatagagtgttgagtgggttgaccccgattgaaaaag
ttcttattaattgcgggttaactgtgaacgggcccaaggtatgtaagaacttagtacatc
atgatatcgcgtctggatcagagggtcttgtcaactcaactgttattttatacaaagaat
tggcaaggtttaaggaaaacacaaggagtcaacaaggcatgtttcacgcttatccggttc
ttgcagatagtaggcaaagagaattagtatccagaatcgctaggaagtattgggggtata
ttatactgtattcaacagaacagggggcgctcaatcaattggtaagaaatcttaaagcgg
gctacttattatttgatgttcatcacaattttctcgtcaagaatctttccaaatccgaaa
gggtcttaatacggactcttatcccacggagagagtggttatttaagcttgagacaagtg
agataaaggagtggtttaagttgatagggtacggtgccctcatcagagagtaataactaa
tgaagtggacccctgctcctgtccttgtcagagtgatatcagattataattattaagaaa
aacaagattcgatttaagtacctatacccagctttgtctggt

BLAST