GenomeNet

>rs:NC_009449 [NC_009449] Honeysuckle yellow vein beta-[Japan:Fukui:2001], complete genome.
accggtggcgagttgggggactcgggggaaaggtgggccccacctttctgtataagtttt
ggtttattgcactctgagtccctgtactttgtcctattcatttttataccctaaaaatga
atttaatgaagaataaaaataaaattaatcattaattttatttacacggagatatgcaat
acattgcttatcgtagtacatggtagttatacggtatatctattccgtacaacatattta
tctactgtatctacccccatatcacttaaccagtgcatcatcacgatatcaattgaatca
atcatctcttcttgtttgaaattggagatgtctgactcatcgtacatcaattccagtgta
tccctgactagctcctctgtcccgttgaagtcgaaagggggattcatatggacgtatgtg
tatggtatgttgcagcgtatacctgttagtaccggttgattcgttgagtatacctggacc
tgcactctgatgaactgttggagccttacgtctatgatgaacttgatgcccttgccgttg
ttatatattatcgtcatctcatcatgctggatctatggtcatctatctatgtccttttat
agagtggtgatttgtgggttgtgtgtctcaatttggtccatgtatttgtgcttatttgtt
cttggaagtattgtttcctattaattctgctatccatcctttatttctgaaagaaaatag
aaagagaaaaagaaaaatggaatcaaagagaaaagaaaatgaaaacaaaaaaagaaccca
acacaaaaatagacaaataaatatagaaaagaacacctattccggcataaagggagcgca
gctcaagtgtcaaaaaaaaaatagaaaagaaatggagaaaaaaaaagaagaaaaaagaaa
tacttgaacgaagtgaaaataaaattaaaatagaaataagaaaataattaaatgaagccc
aaaaacaatttatctcggaaaaagcccaaataaatacccggcccatgacccaatttgaat
ttgactgttcaccataattacaataatgccatgccccccagtgccccccaattgcccccc
gattcaatcgggggacacttatccgtacattttaattggacaacaatacccctgaaaagc
agagataacaggcgcgtgggagtgccctgtaaaagtgcttttctctctcctcaaaccccc
cggagacgatgatcggaggccttccggtcatcattttccgacacgcgcggcagtgcgaac
acggatgtgggcaaaccactacgctacgcagcagccttagctacgccggagcctagctcg
ccaccgttataatatt

BLAST