KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_11
Entry
BSU_rRNA_11       rRNA      T00010                                 

Symbol
rrnW-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_11 (rrnW-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_11 (rrnW-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_11 (rrnW-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_11 (rrnW-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_11 (rrnW-5S)
SSDB
Other DBs
NCBI-GeneID: 2914266
Position
101093..101211
NT seq 119 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_13
Entry
BSU_rRNA_13       rRNA      T00010                                 

Symbol
rrnE-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_13 (rrnE-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_13 (rrnE-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_13 (rrnE-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_13 (rrnE-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_13 (rrnE-5S)
SSDB
Other DBs
NCBI-GeneID: 8303206
Position
640138..640254
NT seq 117 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_15
Entry
BSU_rRNA_15       rRNA      T00010                                 

Symbol
rrnI-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_15 (rrnI-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_15 (rrnI-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_15 (rrnI-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_15 (rrnI-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_15 (rrnI-5S)
SSDB
Other DBs
NCBI-GeneID: 938909
Position
165591..165707
NT seq 117 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_18
Entry
BSU_rRNA_18       rRNA      T00010                                 

Symbol
rrnD-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_18 (rrnD-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_18 (rrnD-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_18 (rrnD-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_18 (rrnD-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_18 (rrnD-5S)
SSDB
Other DBs
NCBI-GeneID: 8303209
Position
951457..951572
NT seq 116 nt   +upstreamnt  +downstreamnt
tctggtgatgatggcgaagaggtcacacccgttcccatgccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacatcgccaggc

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_21
Entry
BSU_rRNA_21       rRNA      T00010                                 

Symbol
rrnB-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_21 (rrnB-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_21 (rrnB-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_21 (rrnB-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_21 (rrnB-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_21 (rrnB-5S)
SSDB
Other DBs
NCBI-GeneID: 8303025
Position
complement(3173818..3173935)
NT seq 118 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaa

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_24
Entry
BSU_rRNA_24       rRNA      T00010                                 

Symbol
rrnH-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_24 (rrnH-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_24 (rrnH-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_24 (rrnH-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_24 (rrnH-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_24 (rrnH-5S)
SSDB
Other DBs
NCBI-GeneID: 938894
Position
171197..171314
NT seq 118 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaa

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_26
Entry
BSU_rRNA_26       rRNA      T00010                                 

Symbol
rrnA-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_26 (rrnA-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_26 (rrnA-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_26 (rrnA-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_26 (rrnA-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_26 (rrnA-5S)
SSDB
Other DBs
NCBI-GeneID: 2914205
Position
35237..35355
NT seq 119 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_28
Entry
BSU_rRNA_28       rRNA      T00010                                 

Symbol
rrnG-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_28 (rrnG-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_28 (rrnG-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_28 (rrnG-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_28 (rrnG-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_28 (rrnG-5S)
SSDB
Other DBs
NCBI-GeneID: 2914262
Position
176197..176315
NT seq 119 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_3
Entry
BSU_rRNA_3        rRNA      T00010                                 

Symbol
rrnO-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_3 (rrnO-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_3 (rrnO-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_3 (rrnO-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_3 (rrnO-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_3 (rrnO-5S)
SSDB
Other DBs
NCBI-GeneID: 2914271
Position
14692..14810
NT seq 119 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_rRNA_8
Entry
BSU_rRNA_8        rRNA      T00010                                 

Symbol
rrnJ-5S
Name
(RefSeq) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu03010  Ribosome
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    BSU_rRNA_8 (rrnJ-5S)
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:bsu03011]
    BSU_rRNA_8 (rrnJ-5S)
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_rRNA_8 (rrnJ-5S)
Ribosome [BR:bsu03011]
 Ribosomal RNAs
  Prokaryotes
   BSU_rRNA_8 (rrnJ-5S)
Non-coding RNAs [BR:bsu03100]
 Ribosomal RNA
  Large subunit rRNA
   BSU_rRNA_8 (rrnJ-5S)
SSDB
Other DBs
NCBI-GeneID: 936652
Position
95237..95354
NT seq 118 nt   +upstreamnt  +downstreamnt
tttggtggcgatagcgaagaggtcacacccgttcccataccgaacacggaagttaagctc
ttcagcgccgatggtagtcgggggtttccccctgtgagagtaggacgccgccaagcaa

DBGET integrated database retrieval system