KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_10
Entry
BSU_tRNA_10       tRNA      T00010                                 

Symbol
trnSL-Met1
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_10 (trnSL-Met1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_10 (trnSL-Met1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_10 (trnSL-Met1)
SSDB
Other DBs
NCBI-GeneID: 936631
Position
70181..70257
NT seq 77 nt   +upstreamnt  +downstreamnt
ggcggtgtagctcagctggctagagcgtacggttcatacccgtgaggtcgggggttcgat
cccctccgccgctacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_21
Entry
BSU_tRNA_21       tRNA      T00010                                 

Symbol
trnE-Met
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_21 (trnE-Met)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_21 (trnE-Met)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_21 (trnE-Met)
SSDB
Other DBs
NCBI-GeneID: 8303207
Position
640268..640344
NT seq 77 nt   +upstreamnt  +downstreamnt
cgcggggtggagcagttcggtagctcgtcgggctcataacccgaaggtcgcaggttcaaa
tcctgcccccgcaacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_33
Entry
BSU_tRNA_33       tRNA      T00010                                 

Symbol
trnD-Met
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_33 (trnD-Met)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_33 (trnD-Met)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_33 (trnD-Met)
SSDB
Other DBs
NCBI-GeneID: 8302934
Position
951954..952030
NT seq 77 nt   +upstreamnt  +downstreamnt
cgcggggtggagcagttcggtagctcgtcgggctcataacccgaaggtcgcaggttcaaa
tcctgcccccgcaacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_61
Entry
BSU_tRNA_61       tRNA      T00010                                 

Symbol
trnB-Met1
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_61 (trnB-Met1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_61 (trnB-Met1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_61 (trnB-Met1)
SSDB
Other DBs
NCBI-GeneID: 8302961
Position
complement(3172872..3172948)
NT seq 77 nt   +upstreamnt  +downstreamnt
ggcggtgtagctcagctggctagagcgtacggttcatacccgtgaggtcgggggttcgat
cccctccgccgctacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_62
Entry
BSU_tRNA_62       tRNA      T00010                                 

Symbol
trnB-Met3
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_62 (trnB-Met3)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_62 (trnB-Met3)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_62 (trnB-Met3)
SSDB
Other DBs
NCBI-GeneID: 8303100
Position
complement(3172793..3172869)
NT seq 77 nt   +upstreamnt  +downstreamnt
ggacctttagctcagttggttagagcagacggctcataaccgtccggtcgtaggttcgag
tcctacaaggtccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_64
Entry
BSU_tRNA_64       tRNA      T00010                                 

Symbol
trnB-Met2
Name
(RefSeq) tRNA-Met
  KO
K14230  tRNA Met
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_64 (trnB-Met2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_64 (trnB-Met2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_64 (trnB-Met2)
SSDB
Other DBs
NCBI-GeneID: 8303035
Position
complement(3172600..3172676)
NT seq 77 nt   +upstreamnt  +downstreamnt
cgcggggtggagcagttcggtagctcgtcgggctcataacccgaaggtcgcaggttcaaa
tcctgcccccgcaacca

DBGET integrated database retrieval system