KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_11
Entry
BSU_tRNA_11       tRNA      T00010                                 

Symbol
trnSL-Glu1
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_11 (trnSL-Glu1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_11 (trnSL-Glu1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_11 (trnSL-Glu1)
SSDB
Other DBs
NCBI-GeneID: 2914278
Position
70267..70338
NT seq 72 nt   +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_3
Entry
BSU_tRNA_3        tRNA      T00010                                 

Symbol
trnY-Glu
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_3 (trnY-Glu)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_3 (trnY-Glu)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_3 (trnY-Glu)
SSDB
Other DBs
NCBI-GeneID: 8303042
Position
complement(4155053..4155124)
NT seq 72 nt   +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_31
Entry
BSU_tRNA_31       tRNA      T00010                                 

Symbol
trnD-Glu
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_31 (trnD-Glu)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_31 (trnD-Glu)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_31 (trnD-Glu)
SSDB
Other DBs
NCBI-GeneID: 8303051
Position
951788..951859
NT seq 72 nt   +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_47
Entry
BSU_tRNA_47       tRNA      T00010                                 

Symbol
trnS-Glu
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_47 (trnS-Glu)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_47 (trnS-Glu)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_47 (trnS-Glu)
SSDB
Other DBs
NCBI-GeneID: 8303006
Position
528903..528974
NT seq 72 nt   +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_72
Entry
BSU_tRNA_72       tRNA      T00010                                 

Symbol
trnB-Glu
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_72 (trnB-Glu)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_72 (trnB-Glu)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_72 (trnB-Glu)
SSDB
Other DBs
NCBI-GeneID: 8302911
Position
complement(3171879..3171950)
NT seq 72 nt   +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_75
Entry
BSU_tRNA_75       tRNA      T00010                                 

Symbol
trnSL-Glu2
Name
(RefSeq) tRNA-Glu
  KO
K14224  tRNA Glu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_75 (trnSL-Glu2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_75 (trnSL-Glu2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_75 (trnSL-Glu2)
SSDB
Other DBs
NCBI-GeneID: 8303028
Position
194205..194279
NT seq 75 nt   +upstreamnt  +downstreamnt
ggcccgttggtcaagcggttaagacaccgccctttcacggcggtaacacgggttcgaatc
ccgtacgggtcacca

DBGET integrated database retrieval system