KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_12
Entry
BSU_tRNA_12       tRNA      T00010                                 

Symbol
trnJ-Val
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_12 (trnJ-Val)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_12 (trnJ-Val)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_12 (trnJ-Val)
SSDB
Other DBs
NCBI-GeneID: 936902
Position
95375..95450
NT seq 76 nt   +upstreamnt  +downstreamnt
ggaggattagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagc
ccgtcatcctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_32
Entry
BSU_tRNA_32       tRNA      T00010                                 

Symbol
trnD-Val
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_32 (trnD-Val)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_32 (trnD-Val)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_32 (trnD-Val)
SSDB
Other DBs
NCBI-GeneID: 8303018
Position
951869..951944
NT seq 76 nt   +upstreamnt  +downstreamnt
ggaggattagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagc
ccgtcatcctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_52
Entry
BSU_tRNA_52       tRNA      T00010                                 

Symbol
trnB-Val
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_52 (trnB-Val)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_52 (trnB-Val)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_52 (trnB-Val)
SSDB
Other DBs
NCBI-GeneID: 8303024
Position
complement(3173722..3173797)
NT seq 76 nt   +upstreamnt  +downstreamnt
ggaggattagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagc
ccgtcatcctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_78
Entry
BSU_tRNA_78       tRNA      T00010                                 

Symbol
trnSL-Val1
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_78 (trnSL-Val1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_78 (trnSL-Val1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_78 (trnSL-Val1)
SSDB
Other DBs
NCBI-GeneID: 8302937
Position
194283..194358
NT seq 76 nt   +upstreamnt  +downstreamnt
ggaggattagctcagctgggagagcatctgccttacaagcagagggtcggcggttcgagc
ccgtcatcctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_83
Entry
BSU_tRNA_83       tRNA      T00010                                 

Symbol
trnSL-Val2
Name
(RefSeq) tRNA-Val
  KO
K14237  tRNA Val
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_83 (trnSL-Val2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_83 (trnSL-Val2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_83 (trnSL-Val2)
SSDB
Other DBs
NCBI-GeneID: 8303193
Position
1262789..1262861
NT seq 73 nt   +upstreamnt  +downstreamnt
gattccgtagctcagctgggagagcgctaccttgacagggtagaggtcgctggttcgagc
ccagtcggaatca

DBGET integrated database retrieval system