KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_15
Entry
BSU_tRNA_15       tRNA      T00010                                 

Symbol
trnJ-Leu1
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_15 (trnJ-Leu1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_15 (trnJ-Leu1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_15 (trnJ-Leu1)
SSDB
Other DBs
NCBI-GeneID: 2914251
Position
95649..95731
NT seq 83 nt   +upstreamnt  +downstreamnt
gcgggtgtggcggaattggcagacgcgctagacttaggatctagtgtctttatgacgtgg
gggttcaagtcccttcacccgca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_17
Entry
BSU_tRNA_17       tRNA      T00010                                 

Symbol
trnJ-Leu2
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_17 (trnJ-Leu2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_17 (trnJ-Leu2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_17 (trnJ-Leu2)
SSDB
Other DBs
NCBI-GeneID: 2914249
Position
95861..95946
NT seq 86 nt   +upstreamnt  +downstreamnt
gccggggtggtggaattggcagacacacaggacttaaaatcctgcggtaggtgactaccg
tgccggttcaagtccggccctcggca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_43
Entry
BSU_tRNA_43       tRNA      T00010                                 

Symbol
trnD-Leu1
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_43 (trnD-Leu1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_43 (trnD-Leu1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_43 (trnD-Leu1)
SSDB
Other DBs
NCBI-GeneID: 8303096
Position
952859..952947
NT seq 89 nt   +upstreamnt  +downstreamnt
gccggggtggtggaattggcagacacacaggacttaaaatcctgcggtaggtgactaccg
tgccggttcaagtccggccctcggcacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_44
Entry
BSU_tRNA_44       tRNA      T00010                                 

Symbol
trnD-Leu2
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_44 (trnD-Leu2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_44 (trnD-Leu2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_44 (trnD-Leu2)
SSDB
Other DBs
NCBI-GeneID: 8303077
Position
953213..953294
NT seq 82 nt   +upstreamnt  +downstreamnt
gccggtgtggcggaattggcagacgcgcacgactcaaaatcgtgttccttctggagtgtc
ggttcgaccccgaccaccggta

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_50
Entry
BSU_tRNA_50       tRNA      T00010                                 

Symbol
trnS-Leu1
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_50 (trnS-Leu1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_50 (trnS-Leu1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_50 (trnS-Leu1)
SSDB
Other DBs
NCBI-GeneID: 8302923
Position
529174..529255
NT seq 82 nt   +upstreamnt  +downstreamnt
gcgggtgtggcggaattggcagacgcgctagacttaggatctagtgtcttacgacgtggg
ggttcgagtcccttcacccgca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_51
Entry
BSU_tRNA_51       tRNA      T00010                                 

Symbol
trnS-Leu2
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_51 (trnS-Leu2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_51 (trnS-Leu2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_51 (trnS-Leu2)
SSDB
Other DBs
NCBI-GeneID: 8302926
Position
529336..529422
NT seq 87 nt   +upstreamnt  +downstreamnt
gcggtcgtggcggaatggcagacgcgctaggttgagggcctagtgggtgaataacccgtg
gaggttcaagtcctctcggccgcatca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_55
Entry
BSU_tRNA_55       tRNA      T00010                                 

Symbol
trnB-Leu1
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_55 (trnB-Leu1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_55 (trnB-Leu1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_55 (trnB-Leu1)
SSDB
Other DBs
NCBI-GeneID: 8302963
Position
complement(3173404..3173490)
NT seq 87 nt   +upstreamnt  +downstreamnt
gcggatgtggcggaattggcagacgcgctagaatcaggctctagtgtctttacagacgtg
ggggttcaagtcccttcatccgcacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_57
Entry
BSU_tRNA_57       tRNA      T00010                                 

Symbol
trnB-Leu2
Name
(RefSeq) tRNA-Leu
  KO
K14228  tRNA Leu
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_57 (trnB-Leu2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_57 (trnB-Leu2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_57 (trnB-Leu2)
SSDB
Other DBs
NCBI-GeneID: 8303001
Position
complement(3173224..3173309)
NT seq 86 nt   +upstreamnt  +downstreamnt
gccggggtggtggaattggcagacacacaggacttaaaatcctgcggtaggtgactaccg
tgccggttcaagtccggccctcggca

DBGET integrated database retrieval system