KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_16
Entry
BSU_tRNA_16       tRNA      T00010                                 

Symbol
trnJ-Gly
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_16 (trnJ-Gly)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_16 (trnJ-Gly)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_16 (trnJ-Gly)
SSDB
Other DBs
NCBI-GeneID: 936900
Position
95772..95846
NT seq 75 nt   +upstreamnt  +downstreamnt
gcggaagtagttcagtggtagaacaccaccttgccaaggtgggggtcgcgggttcgaatc
ccgtcttccgctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_25
Entry
BSU_tRNA_25       tRNA      T00010                                 

Symbol
trnI-Gly
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_25 (trnI-Gly)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_25 (trnI-Gly)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_25 (trnI-Gly)
SSDB
Other DBs
NCBI-GeneID: 938904
Position
165959..166033
NT seq 75 nt   +upstreamnt  +downstreamnt
gcggaagtagttcagtggtagaacaccaccttgccaaggtgggggtcgcgggttcgaatc
ccgtcttccgctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_41
Entry
BSU_tRNA_41       tRNA      T00010                                 

Symbol
trnD-Gly
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_41 (trnD-Gly)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_41 (trnD-Gly)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_41 (trnD-Gly)
SSDB
Other DBs
NCBI-GeneID: 8303097
Position
952701..952775
NT seq 75 nt   +upstreamnt  +downstreamnt
gcggaagtagttcagtggtagaacaccaccttgccaaggtgggggtcgcgggttcgaatc
ccgtcttccgctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_56
Entry
BSU_tRNA_56       tRNA      T00010                                 

Symbol
trnB-Gly1
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_56 (trnB-Gly1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_56 (trnB-Gly1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_56 (trnB-Gly1)
SSDB
Other DBs
NCBI-GeneID: 8302986
Position
complement(3173324..3173398)
NT seq 75 nt   +upstreamnt  +downstreamnt
gcggaagtagttcagtggtagaacaccaccttgccaaggtgggggtcgcgggttcgaatc
ccgtcttccgctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_68
Entry
BSU_tRNA_68       tRNA      T00010                                 

Symbol
trnB-Gly2
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_68 (trnB-Gly2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_68 (trnB-Gly2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_68 (trnB-Gly2)
SSDB
Other DBs
NCBI-GeneID: 8303081
Position
complement(3172247..3172320)
NT seq 74 nt   +upstreamnt  +downstreamnt
gcgggtgtagtttagtggtaaaacctcagccttccaagctgatgtcgtgggttcgattcc
catcacccgctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_80
Entry
BSU_tRNA_80       tRNA      T00010                                 

Symbol
trnE-Gly
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_80 (trnE-Gly)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_80 (trnE-Gly)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_80 (trnE-Gly)
SSDB
Other DBs
NCBI-GeneID: 8303060
Position
635200..635273
NT seq 74 nt   +upstreamnt  +downstreamnt
gcgggtgtagtttagtggtaaaacctcagccttccaagctgatgtcgtgagttcgattct
catcacccgctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_82
Entry
BSU_tRNA_82       tRNA      T00010                                 

Symbol
trnSL-Gly1
Name
(RefSeq) tRNA-Gly
  KO
K14225  tRNA Gly
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_82 (trnSL-Gly1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_82 (trnSL-Gly1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_82 (trnSL-Gly1)
SSDB
Other DBs
NCBI-GeneID: 8302935
Position
967065..967138
NT seq 74 nt   +upstreamnt  +downstreamnt
gcgggtgtagtttagtggtaaaacctcagccttccaagctgatgtcgtgagttcgattct
catcacccgctcca

DBGET integrated database retrieval system