KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_18
Entry
BSU_tRNA_18       tRNA      T00010                                 

Symbol
trnJ-Arg
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_18 (trnJ-Arg)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_18 (trnJ-Arg)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_18 (trnJ-Arg)
SSDB
Other DBs
NCBI-GeneID: 936780
Position
95956..96032
NT seq 77 nt   +upstreamnt  +downstreamnt
gcgcccgtagctcaattggatagagcgtttgactacggatcaaaaggttaggggttcgac
tcctctcgggcgcgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_26
Entry
BSU_tRNA_26       tRNA      T00010                                 

Symbol
trnI-Arg
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_26 (trnI-Arg)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_26 (trnI-Arg)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_26 (trnI-Arg)
SSDB
Other DBs
NCBI-GeneID: 938903
Position
166064..166140
NT seq 77 nt   +upstreamnt  +downstreamnt
gcgcccgtagctcaattggatagagcgtttgactacggatcaaaaggttaggggttcgac
tcctctcgggcgcgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_58
Entry
BSU_tRNA_58       tRNA      T00010                                 

Symbol
trnB-Arg
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_58 (trnB-Arg)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_58 (trnB-Arg)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_58 (trnB-Arg)
SSDB
Other DBs
NCBI-GeneID: 8303107
Position
complement(3173138..3173214)
NT seq 77 nt   +upstreamnt  +downstreamnt
gcgcccgtagctcaattggatagagcgtttgactacggatcaaaaggttaggggttcgac
tcctctcgggcgcgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_79
Entry
BSU_tRNA_79       tRNA      T00010                                 

Symbol
trnE-Arg
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_79 (trnE-Arg)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_79 (trnE-Arg)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_79 (trnE-Arg)
SSDB
Other DBs
NCBI-GeneID: 8303218
Position
635110..635186
NT seq 77 nt   +upstreamnt  +downstreamnt
gcgcccgtagctcaattggatagagcgtttgactacggatcaaaaggttaggggttcgac
tcctctcgggcgcgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_81
Entry
BSU_tRNA_81       tRNA      T00010                                 

Symbol
trnQ-Arg
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_81 (trnQ-Arg)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_81 (trnQ-Arg)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_81 (trnQ-Arg)
SSDB
Other DBs
NCBI-GeneID: 8303047
Position
complement(3545889..3545964)
NT seq 76 nt   +upstreamnt  +downstreamnt
gcgctcgtagctcagttggatagagcggtggtttccggtaccacgtctgtcgggggttcg
aatccctccgagcgcg

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_84
Entry
BSU_tRNA_84       tRNA      T00010                                 

Symbol
trnSL-Arg2
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_84 (trnSL-Arg2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_84 (trnSL-Arg2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_84 (trnSL-Arg2)
SSDB
Other DBs
NCBI-GeneID: 8303222
Position
complement(2899816..2899889)
NT seq 74 nt   +upstreamnt  +downstreamnt
gtcccagtagctcagctggatagagcaacggccttctaagccgtcggtcgggagttcgaa
tctctcctgggacg

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_85
Entry
BSU_tRNA_85       tRNA      T00010                                 

Symbol
trnSL-Arg1
Name
(RefSeq) tRNA-Arg
  KO
K14219  tRNA Arg
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_85 (trnSL-Arg1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_85 (trnSL-Arg1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_85 (trnSL-Arg1)
SSDB
Other DBs
NCBI-GeneID: 8303040
Position
complement(2003276..2003348)
NT seq 73 nt   +upstreamnt  +downstreamnt
gctctagtagcacagcggatagtgcagcagtttcctaaactgcaggtcgggagttcgaat
ctctcctagagcg

DBGET integrated database retrieval system