KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_2
Entry
BSU_tRNA_2        tRNA      T00010                                 

Symbol
trnY-Asp
Name
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_2 (trnY-Asp)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_2 (trnY-Asp)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_2 (trnY-Asp)
SSDB
Other DBs
NCBI-GeneID: 8302974
Position
complement(4154895..4154971)
NT seq 77 nt   +upstreamnt  +downstreamnt
ggtccggtagttcagttggttagaatgcctgcctgtcacgcaggaggtcgcgggttcgag
tcccgtccggaccgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_22
Entry
BSU_tRNA_22       tRNA      T00010                                 

Symbol
trnE-Asp
Name
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_22 (trnE-Asp)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_22 (trnE-Asp)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_22 (trnE-Asp)
SSDB
Other DBs
NCBI-GeneID: 8303086
Position
640405..640481
NT seq 77 nt   +upstreamnt  +downstreamnt
ggtccggtagttcagttggttagaatgcctgcctgtcacgcaggaggtcgcgggttcgag
tcccgtccggaccgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_34
Entry
BSU_tRNA_34       tRNA      T00010                                 

Symbol
trnD-Asp
Name
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_34 (trnD-Asp)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_34 (trnD-Asp)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_34 (trnD-Asp)
SSDB
Other DBs
NCBI-GeneID: 8303039
Position
952042..952118
NT seq 77 nt   +upstreamnt  +downstreamnt
ggtccggtagttcagttggttagaatgcctgcctgtcacgcaggaggtcgcgggttcgag
tcccgtccggaccgcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_65
Entry
BSU_tRNA_65       tRNA      T00010                                 

Symbol
trnB-Asp
Name
(RefSeq) tRNA-Asp
  KO
K14221  tRNA Asp
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_65 (trnB-Asp)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_65 (trnB-Asp)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_65 (trnB-Asp)
SSDB
Other DBs
NCBI-GeneID: 8303106
Position
complement(3172512..3172588)
NT seq 77 nt   +upstreamnt  +downstreamnt
ggtccggtagttcagttggttagaatgcctgcctgtcacgcaggaggtcgcgggttcgag
tcccgtccggaccgcca

DBGET integrated database retrieval system