KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_20
Entry
BSU_tRNA_20       tRNA      T00010                                 

Symbol
trnJ-Ala
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_20 (trnJ-Ala)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_20 (trnJ-Ala)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_20 (trnJ-Ala)
SSDB
Other DBs
NCBI-GeneID: 2914268
Position
96146..96221
NT seq 76 nt   +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatc
ccgctaggctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_28
Entry
BSU_tRNA_28       tRNA      T00010                                 

Symbol
trnI-Ala
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_28 (trnI-Ala)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_28 (trnI-Ala)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_28 (trnI-Ala)
SSDB
Other DBs
NCBI-GeneID: 2914261
Position
166253..166328
NT seq 76 nt   +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatc
ccgctaggctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_6
Entry
BSU_tRNA_6        tRNA      T00010                                 

Symbol
trnO-Ala
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_6 (trnO-Ala)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_6 (trnO-Ala)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_6 (trnO-Ala)
SSDB
Other DBs
NCBI-GeneID: 939967
Position
11552..11627
NT seq 76 nt   +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatc
ccgctaggctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_60
Entry
BSU_tRNA_60       tRNA      T00010                                 

Symbol
trnB-Ala
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_60 (trnB-Ala)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_60 (trnB-Ala)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_60 (trnB-Ala)
SSDB
Other DBs
NCBI-GeneID: 8303103
Position
complement(3172968..3173040)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatc
ccgctaggctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_86
Entry
BSU_tRNA_86       tRNA      T00010                                 

Symbol
trnSL-Ala1
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_86 (trnSL-Ala1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_86 (trnSL-Ala1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_86 (trnSL-Ala1)
SSDB
Other DBs
NCBI-GeneID: 8303184
Position
complement(3194455..3194527)
NT seq 73 nt   +upstreamnt  +downstreamnt
ggggccatagctcagctgggagagcgctacgctggcagcgtagaggtcaggggttcgagc
ccccttggctcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_9
Entry
BSU_tRNA_9        tRNA      T00010                                 

Symbol
trnA-Ala
Name
(RefSeq) tRNA-Ala
  KO
K14218  tRNA Ala
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_9 (trnA-Ala)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_9 (trnA-Ala)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_9 (trnA-Ala)
SSDB
Other DBs
NCBI-GeneID: 2914217
Position
32020..32095
NT seq 76 nt   +upstreamnt  +downstreamnt
ggggccttagctcagctgggagagcgcctgctttgcacgcaggaggtcagcggttcgatc
ccgctaggctccacca

DBGET integrated database retrieval system