KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_23
Entry
BSU_tRNA_23       tRNA      T00010                                 

Symbol
trnI-Asn
Name
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_23 (trnI-Asn)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_23 (trnI-Asn)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_23 (trnI-Asn)
SSDB
Other DBs
NCBI-GeneID: 2914257
Position
165754..165825
NT seq 72 nt   +upstreamnt  +downstreamnt
tccgcagtagctcagtggtagagctatcggctgttaaccgatcggtcgtaggttcgaatc
ctacctgcggag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_29
Entry
BSU_tRNA_29       tRNA      T00010                                 

Symbol
trnD-Asn
Name
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_29 (trnD-Asn)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_29 (trnD-Asn)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_29 (trnD-Asn)
SSDB
Other DBs
NCBI-GeneID: 8303214
Position
951582..951656
NT seq 75 nt   +upstreamnt  +downstreamnt
tccgcagtagctcagtggtagagctatcggctgttaaccgatcggtcgtaggttcgaatc
ctacctgcggagcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_45
Entry
BSU_tRNA_45       tRNA      T00010                                 

Symbol
trnS-Asn
Name
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_45 (trnS-Asn)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_45 (trnS-Asn)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_45 (trnS-Asn)
SSDB
Other DBs
NCBI-GeneID: 8302928
Position
528704..528778
NT seq 75 nt   +upstreamnt  +downstreamnt
tccacagtagctcagtggtagagctatcggctgttaaccgatcggtcgcaggttcgaatc
ctgcctgtggagcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_70
Entry
BSU_tRNA_70       tRNA      T00010                                 

Symbol
trnB-Asn
Name
(RefSeq) tRNA-Asn
  KO
K14220  tRNA Asn
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_70 (trnB-Asn)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_70 (trnB-Asn)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_70 (trnB-Asn)
SSDB
Other DBs
NCBI-GeneID: 8303101
Position
complement(3172070..3172144)
NT seq 75 nt   +upstreamnt  +downstreamnt
tccacagtagctcagtggtagagctatcggctgttaaccgatcggtcgcaggttcgaatc
ctgcctgtggagcca

DBGET integrated database retrieval system