KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_37
Entry
BSU_tRNA_37       tRNA      T00010                                 

Symbol
trnD-Tyr
Name
(RefSeq) tRNA-Tyr
  KO
K14236  tRNA Tyr
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_37 (trnD-Tyr)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_37 (trnD-Tyr)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_37 (trnD-Tyr)
SSDB
Other DBs
NCBI-GeneID: 8303087
Position
952307..952391
NT seq 85 nt   +upstreamnt  +downstreamnt
ggaggggtagcgaagtggctaaacgcggcggactgtaaatccgctccctcagggttcggc
agttcgaatctgcccccctccacca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_77
Entry
BSU_tRNA_77       tRNA      T00010                                 

Symbol
trnSL-Tyr1
Name
(RefSeq) tRNA-Tyr
  KO
K14236  tRNA Tyr
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_77 (trnSL-Tyr1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_77 (trnSL-Tyr1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_77 (trnSL-Tyr1)
SSDB
Other DBs
NCBI-GeneID: 8303046
Position
194458..194542
NT seq 85 nt   +upstreamnt  +downstreamnt
ggaggggtagcgaagtggctaaacgcggcggactgtaaatccgctccctcagggttcggc
agttcgaatctgcccccctccacca

DBGET integrated database retrieval system