KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_40
Entry
BSU_tRNA_40       tRNA      T00010                                 

Symbol
trnD-Gln
Name
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_40 (trnD-Gln)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_40 (trnD-Gln)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_40 (trnD-Gln)
SSDB
Other DBs
NCBI-GeneID: 8303076
Position
952580..952651
NT seq 72 nt   +upstreamnt  +downstreamnt
tgggctatagccaagcggtaaggcaacggactttgactccgtcatgcgttggttcgaatc
cagctagcccag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_48
Entry
BSU_tRNA_48       tRNA      T00010                                 

Symbol
trnS-Gln
Name
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_48 (trnS-Gln)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_48 (trnS-Gln)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_48 (trnS-Gln)
SSDB
Other DBs
NCBI-GeneID: 8302925
Position
528986..529060
NT seq 75 nt   +upstreamnt  +downstreamnt
tgggctatagccaagcggtaaggcaacggactttgactccgtcatgcgttggttcgaatc
cagctagcccagcca

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_73
Entry
BSU_tRNA_73       tRNA      T00010                                 

Symbol
trnSL-Gln1
Name
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_73 (trnSL-Gln1)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_73 (trnSL-Gln1)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_73 (trnSL-Gln1)
SSDB
Other DBs
NCBI-GeneID: 8303182
Position
2563889..2563959
NT seq 71 nt   +upstreamnt  +downstreamnt
tgggctatagccaagcggtaaggcaatggactttgactccgtgatcgttggttcgaatcc
agctagcccag

KEGG   Bacillus subtilis subsp. subtilis 168: BSU_tRNA_74
Entry
BSU_tRNA_74       tRNA      T00010                                 

Symbol
trnSL-Gln2
Name
(RefSeq) tRNA-Gln
  KO
K14223  tRNA Gln
Organism
bsu  Bacillus subtilis subsp. subtilis 168
Pathway
bsu00970  Aminoacyl-tRNA biosynthesis
Brite
KEGG Orthology (KO) [BR:bsu00001]
 09120 Genetic Information Processing
  09122 Translation
   00970 Aminoacyl-tRNA biosynthesis
    BSU_tRNA_74 (trnSL-Gln2)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:bsu03100]
    BSU_tRNA_74 (trnSL-Gln2)
Non-coding RNAs [BR:bsu03100]
 Transfer RNA
  BSU_tRNA_74 (trnSL-Gln2)
SSDB
Other DBs
NCBI-GeneID: 8303064
Position
194547..194621
NT seq 75 nt   +upstreamnt  +downstreamnt
tgggctatagccaagcggtaaggcaacggactttgactccgtcatgcgttggttcgaatc
cagctagcccagtca

DBGET integrated database retrieval system