KEGG   Gramella forsetii: GFO_0611
Entry
GFO_0611          rRNA      T00448                                 

Name
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
gfo  Gramella forsetii
Pathway
gfo03010  Ribosome
Brite
KEGG Orthology (KO) [BR:gfo00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    GFO_0611
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:gfo03011]
    GFO_0611
  09184 RNA family
   03100 Non-coding RNAs [BR:gfo03100]
    GFO_0611
Ribosome [BR:gfo03011]
 Ribosomal RNAs
  Prokaryotes
   GFO_0611
Non-coding RNAs [BR:gfo03100]
 Ribosomal RNA
  Large subunit rRNA
   GFO_0611
SSDB
Position
681394..681502
NT seq 109 nt   +upstreamnt  +downstreamnt
aggtggctatagcaacggggctcacctcttcccatcccgaacagagtagttaagcccgtt
agcgcagatggtactgctgtattgtgggagagtatgtcgccgccttctt

KEGG   Gramella forsetii: GFO_1895
Entry
GFO_1895          rRNA      T00448                                 

Name
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
gfo  Gramella forsetii
Pathway
gfo03010  Ribosome
Brite
KEGG Orthology (KO) [BR:gfo00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    GFO_1895
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:gfo03011]
    GFO_1895
  09184 RNA family
   03100 Non-coding RNAs [BR:gfo03100]
    GFO_1895
Ribosome [BR:gfo03011]
 Ribosomal RNAs
  Prokaryotes
   GFO_1895
Non-coding RNAs [BR:gfo03100]
 Ribosomal RNA
  Large subunit rRNA
   GFO_1895
SSDB
Position
complement(1988843..1988951)
NT seq 109 nt   +upstreamnt  +downstreamnt
aggtggctatagcaacggggctcacctcttcccatcccgaacagagtagttaagcccgtt
agcgcagatggtactgctgtattgtgggagagtatgtcgccgccttctt

KEGG   Gramella forsetii: GFO_2911
Entry
GFO_2911          rRNA      T00448                                 

Name
(GenBank) 5S ribosomal RNA
  KO
K01985  5S ribosomal RNA
Organism
gfo  Gramella forsetii
Pathway
gfo03010  Ribosome
Brite
KEGG Orthology (KO) [BR:gfo00001]
 09120 Genetic Information Processing
  09122 Translation
   03010 Ribosome
    GFO_2911
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03011 Ribosome [BR:gfo03011]
    GFO_2911
  09184 RNA family
   03100 Non-coding RNAs [BR:gfo03100]
    GFO_2911
Ribosome [BR:gfo03011]
 Ribosomal RNAs
  Prokaryotes
   GFO_2911
Non-coding RNAs [BR:gfo03100]
 Ribosomal RNA
  Large subunit rRNA
   GFO_2911
SSDB
Position
complement(3041212..3041320)
NT seq 109 nt   +upstreamnt  +downstreamnt
aggtggctatagcaacggggctcacctcttcccatcccgaacagagtagttaagcccgtt
agcgcagatggtactgctgtattgtgggagagtatgtcgccgccttctt

DBGET integrated database retrieval system