KEGG   Helicobacter pylori PeCan4: HPPC_05880
Entry
HPPC_05880        CDS       T01322                                 

Gene name
secE
Definition
(GenBank) preprotein translocase subunit SecE
  KO
K03073  preprotein translocase subunit SecE
Organism
hpc  Helicobacter pylori PeCan4
Pathway
hpc02024  Quorum sensing
hpc03060  Protein export
hpc03070  Bacterial secretion system
Brite
KEGG Orthology (KO) [BR:hpc00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    HPPC_05880 (secE)
 09130 Environmental Information Processing
  09131 Membrane transport
   03070 Bacterial secretion system
    HPPC_05880 (secE)
 09140 Cellular Processes
  09145 Cellular community - prokaryotes
   02024 Quorum sensing
    HPPC_05880 (secE)
 09180 Brite Hierarchies
  09183 Protein families: signaling and cellular processes
   02044 Secretion system [BR:hpc02044]
    HPPC_05880 (secE)
Secretion system [BR:hpc02044]
 Sec (secretion) system
  Prokaryotic Sec-SRP core components
   HPPC_05880 (secE)
Motif
Pfam: SecE
Other DBs
NCBI-ProteinID: ADO07386
UniProt: E1Q3D8
Position
complement(1201279..1201458)
AA seq 59 aa
MDKWLMQYRLAREELSKVIFPIKEQIRNALVSVLVVVSAITLFLALLDFSLGAFVSSVL
NT seq 180 nt   +upstreamnt  +downstreamnt
atggataaatggctcatgcaatatagattagctagagaagagctttctaaagtgatattt
cctattaaagagcagatacgcaacgcgcttgtttctgttttggtggtggtgagtgctatc
acgctgtttttagctttgttggatttttctctaggggcttttgtttctagtgttctatag

DBGET integrated database retrieval system