Nonomuraea coxensis: Nocox_36445 Help Entry Nocox_36445       CDS       T07466                                  Symbol nudG3 Name (GenBank) CTP pyrophosphohydrolase   KO K03574   8-oxo-dGTP diphosphatase [EC:3.6.1.55] Organism ncx  Nonomuraea coxensis Brite KEGG Orthology (KO) [BR:ncx00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03400 DNA repair and recombination proteins [BR:ncx03400]     Nocox_36445 (nudG3) Enzymes [BR:ncx01000]  3. Hydrolases   3.6  Acting on acid anhydrides    3.6.1  In phosphorus-containing anhydrides     3.6.1.55  8-oxo-dGTP diphosphatase      Nocox_36445 (nudG3) DNA repair and recombination proteins [BR:ncx03400]  Eukaryotic type   Other factors with a suspected DNA repair function    Modulation of nucleotide pools     Nocox_36445 (nudG3)  Prokaryotic type     Nocox_36445 (nudG3) BRITE hierarchy SSDB OrthologParalogGene clusterGFIT Motif Pfam:  NUDIX NUDIX_4 Motif Other DBs NCBI-ProteinID:  QYC44843 Position 7803504..7803803 Genome browser AA seq 99 aa AA seqDB search MPGGRLEPDEDDETGLRREVLEETGLRVEVGPRAGVVERPGPGGVTYVIRDYLATVTGGT AAAGDDAADVRWCTPADLARLPLTEGLLETLTGWGVLPA NT seq 300 nt NT seq  +upstreamnt  +downstreamnt gtgcccggcggccggctggagccggacgaggacgacgagacgggcctgcggcgcgaggtc ctggaggagaccggcctgcgcgtcgaggtcggcccgcgggcgggcgtggtggagcgcccc ggccccggcggcgtcacgtacgtgatccgcgactacctcgccaccgtgaccggcgggacg gcggcggccggtgacgacgccgccgacgtccgctggtgcacgccggccgacctcgcccgg ctgccgctcaccgagggcctgctggagacgctcaccggctggggagtgctaccggcttga

All links   Gene (1) NCBI-PROTEINID (1) Protein domain (2) Pfam (2) All databases (3) Download RDF

DBGET integrated database retrieval system