Pseudomonas cannabina pv. alisalensis: JGS08_27225 Help Entry JGS08_27225       CDS       T07379                                  Name (GenBank) HU family DNA-binding protein   KO K03530   DNA-binding protein HU-beta Organism pcab  Pseudomonas cannabina pv. alisalensis Brite KEGG Orthology (KO) [BR:pcab00001]  09180 Brite Hierarchies   09182 Protein families: genetic information processing    03032 DNA replication proteins [BR:pcab03032]     JGS08_27225    03036 Chromosome and associated proteins [BR:pcab03036]     JGS08_27225    03400 DNA repair and recombination proteins [BR:pcab03400]     JGS08_27225 DNA replication proteins [BR:pcab03032]  Prokaryotic type   DNA Replication Initiation Factors    Initiation factors (bacterial)     JGS08_27225 Chromosome and associated proteins [BR:pcab03036]  Prokaryotic type   Nucleoid associated proteins    HU (heat unstable protein)     JGS08_27225 DNA repair and recombination proteins [BR:pcab03400]  Prokaryotic type   DSBR (double strand breaks repair)    NHEJ (non-homologous end-joining)     SHIIR (short-homology-independent illegitimate recombination)      Supressor       JGS08_27225 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  Bac_DNA_binding HU-CCDC81_bac_2 HU-HIG HU-CCDC81_euk_2 SSPI Motif Other DBs NCBI-ProteinID:  QQN24880 Position unnamed:1451..1744 Genome browser AA seq 97 aa AA seqDB search MALTKDQLVAGIAEAIDAPKTTARNALEQLGQIVADQLESGAEITLPGIGKLKVAERPAR TGRNPSTGASIDIAAKKVVKFVSAKVLNDAINKGGVS NT seq 294 nt NT seq  +upstreamnt  +downstreamnt atggctctgacgaaagaccaattggttgccggtattgcagaagctatcgatgcgccaaaa accaccgcgcgtaatgctcttgagcaattgggacagatcgttgccgaccaactggaaagc ggtgcagaaatcactctaccgggcatcggcaaactgaaagtggcagagcgtccagcacgc actggccgcaacccttcgactggtgcctctatcgacattgctgccaagaaagtcgtcaag ttcgtctcggctaaagtgctgaacgacgcgatcaacaagggcggcgtttcatag

All links   Gene (1) NCBI-PROTEINID (1) Protein domain (5) Pfam (5) All databases (6) Download RDF

DBGET integrated database retrieval system