GenomeNet

Database: PDB
Entry: 4P0S
LinkDB: 4P0S
Original site: 4P0S 
HEADER    HYDROLASE/DNA                           22-FEB-14   4P0S              
TITLE     HUMAN MUS81-EME1-3'FLAP DNA COMPLEX                                   
COMPND    MOL_ID: 1;                                                            
COMPND   2 MOLECULE: CROSSOVER JUNCTION ENDONUCLEASE MUS81;                     
COMPND   3 CHAIN: A, C, E, G;                                                   
COMPND   4 EC: 3.1.22.-;                                                        
COMPND   5 ENGINEERED: YES;                                                     
COMPND   6 MOL_ID: 2;                                                           
COMPND   7 MOLECULE: CROSSOVER JUNCTION ENDONUCLEASE EME1;                      
COMPND   8 CHAIN: B, D, F, H;                                                   
COMPND   9 SYNONYM: MMS4 HOMOLOG,HMMS4;                                         
COMPND  10 EC: 3.1.22.-;                                                        
COMPND  11 ENGINEERED: YES;                                                     
COMPND  12 MOL_ID: 3;                                                           
COMPND  13 MOLECULE: DNA GAATGTGTGTCT;                                          
COMPND  14 CHAIN: I, M, Q, U;                                                   
COMPND  15 ENGINEERED: YES;                                                     
COMPND  16 MOL_ID: 4;                                                           
COMPND  17 MOLECULE: DNA TAGACACACATTCGGGACATGCAG;                              
COMPND  18 CHAIN: J, N, R, V;                                                   
COMPND  19 ENGINEERED: YES;                                                     
COMPND  20 MOL_ID: 5;                                                           
COMPND  21 MOLECULE: DNA TCTGCATGTCATT;                                         
COMPND  22 CHAIN: L, P, T, X;                                                   
COMPND  23 ENGINEERED: YES                                                      
SOURCE    MOL_ID: 1;                                                            
SOURCE   2 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE   3 ORGANISM_COMMON: HUMAN;                                              
SOURCE   4 ORGANISM_TAXID: 9606;                                                
SOURCE   5 GENE: MUS81;                                                         
SOURCE   6 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE   7 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE   8 EXPRESSION_SYSTEM_STRAIN: ROSETTA(DE3);                              
SOURCE   9 MOL_ID: 2;                                                           
SOURCE  10 ORGANISM_SCIENTIFIC: HOMO SAPIENS;                                   
SOURCE  11 ORGANISM_COMMON: HUMAN;                                              
SOURCE  12 ORGANISM_TAXID: 9606;                                                
SOURCE  13 GENE: EME1, MMS4;                                                    
SOURCE  14 EXPRESSION_SYSTEM: ESCHERICHIA COLI;                                 
SOURCE  15 EXPRESSION_SYSTEM_TAXID: 562;                                        
SOURCE  16 EXPRESSION_SYSTEM_STRAIN: ROSETTA(DE3);                              
SOURCE  17 MOL_ID: 3;                                                           
SOURCE  18 SYNTHETIC: YES;                                                      
SOURCE  19 ORGANISM_SCIENTIFIC: SYNTHETIC CONSTRUCT;                            
SOURCE  20 ORGANISM_TAXID: 32630;                                               
SOURCE  21 MOL_ID: 4;                                                           
SOURCE  22 SYNTHETIC: YES;                                                      
SOURCE  23 ORGANISM_SCIENTIFIC: SYNTHETIC CONSTRUCT;                            
SOURCE  24 ORGANISM_TAXID: 32630;                                               
SOURCE  25 MOL_ID: 5;                                                           
SOURCE  26 SYNTHETIC: YES;                                                      
SOURCE  27 ORGANISM_SCIENTIFIC: SYNTHETIC CONSTRUCT;                            
SOURCE  28 ORGANISM_TAXID: 32630                                                
KEYWDS    RESOLVASE, HYDROLASE-DNA COMPLEX                                      
EXPDTA    X-RAY DIFFRACTION                                                     
AUTHOR    G.H.GWON,K.BAEK,Y.CHO                                                 
REVDAT   2   14-JAN-15 4P0S    1       DBREF                                    
REVDAT   1   28-MAY-14 4P0S    0                                                
JRNL        AUTH   G.H.GWON,A.JO,K.BAEK,K.S.JIN,Y.FU,J.B.LEE,Y.KIM,Y.CHO        
JRNL        TITL   CRYSTAL STRUCTURES OF THE STRUCTURE-SELECTIVE NUCLEASE       
JRNL        TITL 2 MUS81-EME1 BOUND TO FLAP DNA SUBSTRATES.                     
JRNL        REF    EMBO J.                       V.  33  1061 2014              
JRNL        REFN                   ESSN 1460-2075                               
JRNL        PMID   24733841                                                     
JRNL        DOI    10.1002/EMBJ.201487820                                       
REMARK   2                                                                      
REMARK   2 RESOLUTION.    6.00 ANGSTROMS.                                       
REMARK   3                                                                      
REMARK   3 REFINEMENT.                                                          
REMARK   3   PROGRAM     : PHENIX (PHENIX.REFINE: 1.8_1069)                     
REMARK   3   AUTHORS     : PAUL ADAMS,PAVEL AFONINE,VINCENT CHEN,IAN            
REMARK   3               : DAVIS,KRESHNA GOPAL,RALF GROSSE-KUNSTLEVE,           
REMARK   3               : LI-WEI HUNG,ROBERT IMMORMINO,TOM IOERGER,            
REMARK   3               : AIRLIE MCCOY,ERIK MCKEE,NIGEL MORIARTY,              
REMARK   3               : REETAL PAI,RANDY READ,JANE RICHARDSON,               
REMARK   3               : DAVID RICHARDSON,TOD ROMO,JIM SACCHETTINI,           
REMARK   3               : NICHOLAS SAUTER,JACOB SMITH,LAURENT                  
REMARK   3               : STORONI,TOM TERWILLIGER,PETER ZWART                  
REMARK   3                                                                      
REMARK   3    REFINEMENT TARGET : ML                                            
REMARK   3                                                                      
REMARK   3  DATA USED IN REFINEMENT.                                            
REMARK   3   RESOLUTION RANGE HIGH (ANGSTROMS) : 6.00                           
REMARK   3   RESOLUTION RANGE LOW  (ANGSTROMS) : 29.98                          
REMARK   3   MIN(FOBS/SIGMA_FOBS)              : 1.350                          
REMARK   3   COMPLETENESS FOR RANGE        (%) : 99.4                           
REMARK   3   NUMBER OF REFLECTIONS             : 12803                          
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT.                                     
REMARK   3   R VALUE     (WORKING + TEST SET) : 0.253                           
REMARK   3   R VALUE            (WORKING SET) : 0.250                           
REMARK   3   FREE R VALUE                     : 0.308                           
REMARK   3   FREE R VALUE TEST SET SIZE   (%) : 5.140                           
REMARK   3   FREE R VALUE TEST SET COUNT      : 658                             
REMARK   3                                                                      
REMARK   3  FIT TO DATA USED IN REFINEMENT (IN BINS).                           
REMARK   3   BIN  RESOLUTION RANGE  COMPL.    NWORK NFREE   RWORK  RFREE        
REMARK   3     1 29.9782 - 10.1526    0.98     2501   120  0.2171 0.2667        
REMARK   3     2 10.1526 -  8.1110    1.00     2453   124  0.2414 0.2939        
REMARK   3     3  8.1110 -  7.1012    1.00     2381   148  0.2899 0.3625        
REMARK   3     4  7.1012 -  6.4591    1.00     2422   133  0.3304 0.3796        
REMARK   3     5  6.4591 -  6.0001    1.00     2388   133  0.3708 0.4554        
REMARK   3                                                                      
REMARK   3  BULK SOLVENT MODELLING.                                             
REMARK   3   METHOD USED        : FLAT BULK SOLVENT MODEL                       
REMARK   3   SOLVENT RADIUS     : 1.11                                          
REMARK   3   SHRINKAGE RADIUS   : 0.90                                          
REMARK   3   K_SOL              : NULL                                          
REMARK   3   B_SOL              : NULL                                          
REMARK   3                                                                      
REMARK   3  ERROR ESTIMATES.                                                    
REMARK   3   COORDINATE ERROR (MAXIMUM-LIKELIHOOD BASED)     : 1.080            
REMARK   3   PHASE ERROR (DEGREES, MAXIMUM-LIKELIHOOD BASED) : 37.960           
REMARK   3                                                                      
REMARK   3  B VALUES.                                                           
REMARK   3   FROM WILSON PLOT           (A**2) : NULL                           
REMARK   3   MEAN B VALUE      (OVERALL, A**2) : NULL                           
REMARK   3   OVERALL ANISOTROPIC B VALUE.                                       
REMARK   3    B11 (A**2) : NULL                                                 
REMARK   3    B22 (A**2) : NULL                                                 
REMARK   3    B33 (A**2) : NULL                                                 
REMARK   3    B12 (A**2) : NULL                                                 
REMARK   3    B13 (A**2) : NULL                                                 
REMARK   3    B23 (A**2) : NULL                                                 
REMARK   3                                                                      
REMARK   3  TWINNING INFORMATION.                                               
REMARK   3   FRACTION: NULL                                                     
REMARK   3   OPERATOR: NULL                                                     
REMARK   3                                                                      
REMARK   3  DEVIATIONS FROM IDEAL VALUES.                                       
REMARK   3                 RMSD          COUNT                                  
REMARK   3   BOND      :  0.018          21544                                  
REMARK   3   ANGLE     :  2.353          29796                                  
REMARK   3   CHIRALITY :  0.106           3440                                  
REMARK   3   PLANARITY :  0.010           3280                                  
REMARK   3   DIHEDRAL  : 20.493           8304                                  
REMARK   3                                                                      
REMARK   3  TLS DETAILS                                                         
REMARK   3   NUMBER OF TLS GROUPS  : 12                                         
REMARK   3   TLS GROUP : 1                                                      
REMARK   3    SELECTION: CHAIN 'A' AND (RESID 256 THROUGH 463 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  28.5292  48.9391 -30.2391              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.5525 T22:   1.0644                                     
REMARK   3      T33:   0.5614 T12:  -0.2327                                     
REMARK   3      T13:  -0.2496 T23:  -0.0495                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.3493 L22:   0.6466                                     
REMARK   3      L33:   0.1784 L12:  -0.1719                                     
REMARK   3      L13:   0.0327 L23:  -0.0018                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.2204 S12:   0.0666 S13:  -1.0675                       
REMARK   3      S21:   0.4421 S22:   0.1618 S23:  -0.0686                       
REMARK   3      S31:   0.3585 S32:   0.0046 S33:   0.0420                       
REMARK   3   TLS GROUP : 2                                                      
REMARK   3    SELECTION: CHAIN 'A' AND (RESID 472 THROUGH 551 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  37.3156  27.0168 -64.9823              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.8517 T22:   0.9299                                     
REMARK   3      T33:   0.6913 T12:  -0.4630                                     
REMARK   3      T13:  -0.0427 T23:  -0.2279                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.4108 L22:   0.3191                                     
REMARK   3      L33:   0.1320 L12:   0.2400                                     
REMARK   3      L13:   0.1640 L23:   0.0099                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.1909 S12:   0.1816 S13:  -0.5414                       
REMARK   3      S21:   0.1529 S22:  -0.0345 S23:  -0.3008                       
REMARK   3      S31:  -0.0834 S32:  -0.1904 S33:   0.1531                       
REMARK   3   TLS GROUP : 3                                                      
REMARK   3    SELECTION: CHAIN 'B' AND (RESID 233 THROUGH 566 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  32.1195  49.8151 -48.8821              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.9922 T22:   0.5706                                     
REMARK   3      T33:   0.8108 T12:  -0.4019                                     
REMARK   3      T13:   0.4898 T23:   0.2524                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.0103 L22:   0.1081                                     
REMARK   3      L33:   0.0160 L12:  -0.1714                                     
REMARK   3      L13:  -0.1039 L23:  -0.0391                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.3481 S12:   0.3130 S13:   0.2438                       
REMARK   3      S21:   0.0561 S22:   0.1395 S23:   0.3359                       
REMARK   3      S31:   0.4767 S32:  -0.6653 S33:  -0.8728                       
REMARK   3   TLS GROUP : 4                                                      
REMARK   3    SELECTION: CHAIN 'C' AND (RESID 256 THROUGH 463 )                 
REMARK   3    ORIGIN FOR THE GROUP (A): -21.5165  51.9951 -35.9563              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.8339 T22:   0.4564                                     
REMARK   3      T33:   1.5587 T12:   0.2319                                     
REMARK   3      T13:   0.0329 T23:  -0.3503                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.1440 L22:   0.1309                                     
REMARK   3      L33:  -0.0171 L12:   0.0063                                     
REMARK   3      L13:   0.0314 L23:  -0.0617                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.2602 S12:   0.3095 S13:  -0.1478                       
REMARK   3      S21:  -0.2829 S22:   0.0351 S23:   0.1989                       
REMARK   3      S31:   0.2567 S32:   0.2512 S33:   0.4127                       
REMARK   3   TLS GROUP : 5                                                      
REMARK   3    SELECTION: CHAIN 'C' AND (RESID 472 THROUGH 551 )                 
REMARK   3    ORIGIN FOR THE GROUP (A): -21.0587  78.9230  -2.1667              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.0082 T22:   1.9526                                     
REMARK   3      T33:   0.7398 T12:  -0.4041                                     
REMARK   3      T13:   0.4644 T23:   0.0670                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   1.7036 L22:   0.2924                                     
REMARK   3      L33:   0.5134 L12:  -0.3449                                     
REMARK   3      L13:   0.3745 L23:  -0.2148                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.0320 S12:  -0.3895 S13:   0.4085                       
REMARK   3      S21:  -0.0610 S22:  -0.4233 S23:  -0.2821                       
REMARK   3      S31:  -0.3445 S32:   0.3094 S33:  -0.4959                       
REMARK   3   TLS GROUP : 6                                                      
REMARK   3    SELECTION: CHAIN 'D' AND (RESID 233 THROUGH 566 )                 
REMARK   3    ORIGIN FOR THE GROUP (A): -17.5108  69.9587 -28.5133              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.2290 T22:  -0.0741                                     
REMARK   3      T33:  -0.3955 T12:   0.2061                                     
REMARK   3      T13:  -0.7570 T23:  -0.5389                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.5226 L22:  -0.1792                                     
REMARK   3      L33:   0.1772 L12:   0.0093                                     
REMARK   3      L13:   0.0316 L23:  -0.2343                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.2379 S12:  -0.3413 S13:   0.1400                       
REMARK   3      S21:   0.3308 S22:  -0.1951 S23:  -0.0588                       
REMARK   3      S31:  -0.0523 S32:   0.1915 S33:  -0.3201                       
REMARK   3   TLS GROUP : 7                                                      
REMARK   3    SELECTION: CHAIN 'E' AND (RESID 256 THROUGH 463 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  41.6498 112.6686 -76.2655              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.1618 T22:   1.1616                                     
REMARK   3      T33:   0.4891 T12:  -0.4914                                     
REMARK   3      T13:  -0.0633 T23:   0.4697                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.1985 L22:   0.0953                                     
REMARK   3      L33:   0.4148 L12:   0.1390                                     
REMARK   3      L13:  -0.0227 L23:  -0.0461                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.0293 S12:   0.4217 S13:   0.2735                       
REMARK   3      S21:   0.1203 S22:  -0.1913 S23:  -0.3306                       
REMARK   3      S31:  -0.6421 S32:   0.3787 S33:  -0.1851                       
REMARK   3   TLS GROUP : 8                                                      
REMARK   3    SELECTION: CHAIN 'E' AND (RESID 472 THROUGH 551 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  36.6678 131.3626 -37.2123              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   4.3148 T22:   2.7513                                     
REMARK   3      T33:   5.6605 T12:  -0.3723                                     
REMARK   3      T13:   0.5100 T23:   0.3246                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.0015 L22:   0.0090                                     
REMARK   3      L33:   0.0052 L12:   0.0437                                     
REMARK   3      L13:   0.0359 L23:  -0.0108                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.0044 S12:   0.1504 S13:  -0.3162                       
REMARK   3      S21:   0.2649 S22:  -0.2345 S23:   0.3886                       
REMARK   3      S31:  -0.2937 S32:  -0.3896 S33:   0.0002                       
REMARK   3   TLS GROUP : 9                                                      
REMARK   3    SELECTION: CHAIN 'F' AND (RESID 233 THROUGH 566 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  36.7915 112.6004 -57.7672              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.4869 T22:   0.6859                                     
REMARK   3      T33:   0.6432 T12:  -0.1433                                     
REMARK   3      T13:  -0.3504 T23:   0.4250                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   1.3274 L22:   0.4460                                     
REMARK   3      L33:   2.2553 L12:  -0.2436                                     
REMARK   3      L13:  -1.2762 L23:  -0.1250                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.4060 S12:  -1.2711 S13:   0.4385                       
REMARK   3      S21:   0.2459 S22:   0.3241 S23:   0.4464                       
REMARK   3      S31:  -0.8704 S32:   0.8338 S33:   2.3644                       
REMARK   3   TLS GROUP : 10                                                     
REMARK   3    SELECTION: CHAIN 'G' AND (RESID 256 THROUGH 463 )                 
REMARK   3    ORIGIN FOR THE GROUP (A):  -9.3870 120.9039 -74.1990              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.3328 T22:   0.8467                                     
REMARK   3      T33:   0.8333 T12:  -0.9641                                     
REMARK   3      T13:  -0.0192 T23:  -0.2337                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.7354 L22:   0.2496                                     
REMARK   3      L33:   0.3940 L12:   0.0269                                     
REMARK   3      L13:  -0.1141 L23:   0.1304                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.4209 S12:   0.3394 S13:   0.5012                       
REMARK   3      S21:   0.0480 S22:  -0.2145 S23:   0.2313                       
REMARK   3      S31:  -0.0491 S32:   0.0139 S33:   0.4715                       
REMARK   3   TLS GROUP : 11                                                     
REMARK   3    SELECTION: CHAIN 'G' AND (RESID 472 THROUGH 551 )                 
REMARK   3    ORIGIN FOR THE GROUP (A): -13.6882  98.0090-109.0319              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   1.1680 T22:   1.3063                                     
REMARK   3      T33:   0.6408 T12:   0.6324                                     
REMARK   3      T13:  -0.3274 T23:  -0.2150                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.6328 L22:   0.1747                                     
REMARK   3      L33:   1.1652 L12:  -0.0165                                     
REMARK   3      L13:  -0.1778 L23:  -0.2727                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:  -0.0759 S12:   0.5990 S13:  -0.1596                       
REMARK   3      S21:  -0.1918 S22:  -0.3765 S23:   0.1334                       
REMARK   3      S31:   0.6017 S32:   0.5584 S33:  -0.6143                       
REMARK   3   TLS GROUP : 12                                                     
REMARK   3    SELECTION: CHAIN 'H' AND (RESID 233 THROUGH 566 )                 
REMARK   3    ORIGIN FOR THE GROUP (A): -10.7260 103.7623 -81.1292              
REMARK   3    T TENSOR                                                          
REMARK   3      T11:   0.4345 T22:   0.9269                                     
REMARK   3      T33:  -1.2492 T12:  -0.7429                                     
REMARK   3      T13:   0.3824 T23:  -0.1103                                     
REMARK   3    L TENSOR                                                          
REMARK   3      L11:   0.3176 L22:  -0.0183                                     
REMARK   3      L33:   0.0760 L12:  -0.1765                                     
REMARK   3      L13:   0.0701 L23:  -0.2356                                     
REMARK   3    S TENSOR                                                          
REMARK   3      S11:   0.2728 S12:   0.3058 S13:  -0.7545                       
REMARK   3      S21:  -0.0118 S22:  -0.3674 S23:  -0.8576                       
REMARK   3      S31:   0.0118 S32:  -0.1583 S33:  -0.4004                       
REMARK   3                                                                      
REMARK   3  NCS DETAILS                                                         
REMARK   3   NUMBER OF NCS GROUPS : NULL                                        
REMARK   3                                                                      
REMARK   3  OTHER REFINEMENT REMARKS: NULL                                      
REMARK   4                                                                      
REMARK   4 4P0S COMPLIES WITH FORMAT V. 3.30, 13-JUL-11                         
REMARK 100                                                                      
REMARK 100 THIS ENTRY HAS BEEN PROCESSED BY RCSB ON 22-FEB-14.                  
REMARK 100 THE DEPOSITION ID IS D_1000200447.                                   
REMARK 200                                                                      
REMARK 200 EXPERIMENTAL DETAILS                                                 
REMARK 200  EXPERIMENT TYPE                : X-RAY DIFFRACTION                  
REMARK 200  DATE OF DATA COLLECTION        : 16-SEP-13                          
REMARK 200  TEMPERATURE           (KELVIN) : 103                                
REMARK 200  PH                             : NULL                               
REMARK 200  NUMBER OF CRYSTALS USED        : NULL                               
REMARK 200                                                                      
REMARK 200  SYNCHROTRON              (Y/N) : Y                                  
REMARK 200  RADIATION SOURCE               : PAL/PLS                            
REMARK 200  BEAMLINE                       : 5C (4A)                            
REMARK 200  X-RAY GENERATOR MODEL          : NULL                               
REMARK 200  MONOCHROMATIC OR LAUE    (M/L) : NULL                               
REMARK 200  WAVELENGTH OR RANGE        (A) : 0.9795                             
REMARK 200  MONOCHROMATOR                  : NULL                               
REMARK 200  OPTICS                         : NULL                               
REMARK 200                                                                      
REMARK 200  DETECTOR TYPE                  : CCD                                
REMARK 200  DETECTOR MANUFACTURER          : ADSC QUANTUM 315R                  
REMARK 200  INTENSITY-INTEGRATION SOFTWARE : NULL                               
REMARK 200  DATA SCALING SOFTWARE          : NULL                               
REMARK 200                                                                      
REMARK 200  NUMBER OF UNIQUE REFLECTIONS   : 16874                              
REMARK 200  RESOLUTION RANGE HIGH      (A) : 5.920                              
REMARK 200  RESOLUTION RANGE LOW       (A) : 50.000                             
REMARK 200  REJECTION CRITERIA  (SIGMA(I)) : NULL                               
REMARK 200                                                                      
REMARK 200 OVERALL.                                                             
REMARK 200  COMPLETENESS FOR RANGE     (%) : 99.5                               
REMARK 200  DATA REDUNDANCY                : 9.300                              
REMARK 200  R MERGE                    (I) : NULL                               
REMARK 200  R SYM                      (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR THE DATA SET  : 43.7000                            
REMARK 200                                                                      
REMARK 200 IN THE HIGHEST RESOLUTION SHELL.                                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE HIGH (A) : NULL                     
REMARK 200  HIGHEST RESOLUTION SHELL, RANGE LOW  (A) : NULL                     
REMARK 200  COMPLETENESS FOR SHELL     (%) : NULL                               
REMARK 200  DATA REDUNDANCY IN SHELL       : NULL                               
REMARK 200  R MERGE FOR SHELL          (I) : NULL                               
REMARK 200  R SYM FOR SHELL            (I) : NULL                               
REMARK 200  <I/SIGMA(I)> FOR SHELL         : NULL                               
REMARK 200                                                                      
REMARK 200 DIFFRACTION PROTOCOL: SINGLE WAVELENGTH                              
REMARK 200 METHOD USED TO DETERMINE THE STRUCTURE: NULL                         
REMARK 200 SOFTWARE USED: NULL                                                  
REMARK 200 STARTING MODEL: NULL                                                 
REMARK 200                                                                      
REMARK 200 REMARK: NULL                                                         
REMARK 280                                                                      
REMARK 280 CRYSTAL                                                              
REMARK 280 SOLVENT CONTENT, VS   (%): 63.38                                     
REMARK 280 MATTHEWS COEFFICIENT, VM (ANGSTROMS**3/DA): 3.36                     
REMARK 280                                                                      
REMARK 280 CRYSTALLIZATION CONDITIONS: PEG400, TRIS, DTT, VAPOR DIFFUSION,      
REMARK 280  HANGING DROP, TEMPERATURE 291K                                      
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY                                            
REMARK 290 SYMMETRY OPERATORS FOR SPACE GROUP: C 2 2 21                         
REMARK 290                                                                      
REMARK 290      SYMOP   SYMMETRY                                                
REMARK 290     NNNMMM   OPERATOR                                                
REMARK 290       1555   X,Y,Z                                                   
REMARK 290       2555   -X,-Y,Z+1/2                                             
REMARK 290       3555   -X,Y,-Z+1/2                                             
REMARK 290       4555   X,-Y,-Z                                                 
REMARK 290       5555   X+1/2,Y+1/2,Z                                           
REMARK 290       6555   -X+1/2,-Y+1/2,Z+1/2                                     
REMARK 290       7555   -X+1/2,Y+1/2,-Z+1/2                                     
REMARK 290       8555   X+1/2,-Y+1/2,-Z                                         
REMARK 290                                                                      
REMARK 290     WHERE NNN -> OPERATOR NUMBER                                     
REMARK 290           MMM -> TRANSLATION VECTOR                                  
REMARK 290                                                                      
REMARK 290 CRYSTALLOGRAPHIC SYMMETRY TRANSFORMATIONS                            
REMARK 290 THE FOLLOWING TRANSFORMATIONS OPERATE ON THE ATOM/HETATM             
REMARK 290 RECORDS IN THIS ENTRY TO PRODUCE CRYSTALLOGRAPHICALLY                
REMARK 290 RELATED MOLECULES.                                                   
REMARK 290   SMTRY1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   2 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   2  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   2  0.000000  0.000000  1.000000      215.12000            
REMARK 290   SMTRY1   3 -1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   3  0.000000  1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   3  0.000000  0.000000 -1.000000      215.12000            
REMARK 290   SMTRY1   4  1.000000  0.000000  0.000000        0.00000            
REMARK 290   SMTRY2   4  0.000000 -1.000000  0.000000        0.00000            
REMARK 290   SMTRY3   4  0.000000  0.000000 -1.000000        0.00000            
REMARK 290   SMTRY1   5  1.000000  0.000000  0.000000       46.22100            
REMARK 290   SMTRY2   5  0.000000  1.000000  0.000000      125.37900            
REMARK 290   SMTRY3   5  0.000000  0.000000  1.000000        0.00000            
REMARK 290   SMTRY1   6 -1.000000  0.000000  0.000000       46.22100            
REMARK 290   SMTRY2   6  0.000000 -1.000000  0.000000      125.37900            
REMARK 290   SMTRY3   6  0.000000  0.000000  1.000000      215.12000            
REMARK 290   SMTRY1   7 -1.000000  0.000000  0.000000       46.22100            
REMARK 290   SMTRY2   7  0.000000  1.000000  0.000000      125.37900            
REMARK 290   SMTRY3   7  0.000000  0.000000 -1.000000      215.12000            
REMARK 290   SMTRY1   8  1.000000  0.000000  0.000000       46.22100            
REMARK 290   SMTRY2   8  0.000000 -1.000000  0.000000      125.37900            
REMARK 290   SMTRY3   8  0.000000  0.000000 -1.000000        0.00000            
REMARK 290                                                                      
REMARK 290 REMARK: NULL                                                         
REMARK 300                                                                      
REMARK 300 BIOMOLECULE: 1, 2, 3, 4                                              
REMARK 300 SEE REMARK 350 FOR THE AUTHOR PROVIDED AND/OR PROGRAM                
REMARK 300 GENERATED ASSEMBLY INFORMATION FOR THE STRUCTURE IN                  
REMARK 300 THIS ENTRY. THE REMARK MAY ALSO PROVIDE INFORMATION ON               
REMARK 300 BURIED SURFACE AREA.                                                 
REMARK 350                                                                      
REMARK 350 COORDINATES FOR A COMPLETE MULTIMER REPRESENTING THE KNOWN           
REMARK 350 BIOLOGICALLY SIGNIFICANT OLIGOMERIZATION STATE OF THE                
REMARK 350 MOLECULE CAN BE GENERATED BY APPLYING BIOMT TRANSFORMATIONS          
REMARK 350 GIVEN BELOW.  BOTH NON-CRYSTALLOGRAPHIC AND                          
REMARK 350 CRYSTALLOGRAPHIC OPERATIONS ARE GIVEN.                               
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 1                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: PENTAMERIC                        
REMARK 350 APPLY THE FOLLOWING TO CHAINS: A, B, I, J, L                         
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 2                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: PENTAMERIC                        
REMARK 350 APPLY THE FOLLOWING TO CHAINS: C, D, U, V, X                         
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 3                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: PENTAMERIC                        
REMARK 350 APPLY THE FOLLOWING TO CHAINS: E, F, Q, R, T                         
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 350                                                                      
REMARK 350 BIOMOLECULE: 4                                                       
REMARK 350 AUTHOR DETERMINED BIOLOGICAL UNIT: PENTAMERIC                        
REMARK 350 APPLY THE FOLLOWING TO CHAINS: G, H, M, N, P                         
REMARK 350   BIOMT1   1  1.000000  0.000000  0.000000        0.00000            
REMARK 350   BIOMT2   1  0.000000  1.000000  0.000000        0.00000            
REMARK 350   BIOMT3   1  0.000000  0.000000  1.000000        0.00000            
REMARK 465                                                                      
REMARK 465 MISSING RESIDUES                                                     
REMARK 465 THE FOLLOWING RESIDUES WERE NOT LOCATED IN THE                       
REMARK 465 EXPERIMENT. (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 465 IDENTIFIER; SSSEQ=SEQUENCE NUMBER; I=INSERTION CODE.)                
REMARK 465                                                                      
REMARK 465   M RES C SSSEQI                                                     
REMARK 465     SER A   246                                                      
REMARK 465     ALA A   247                                                      
REMARK 465     GLU A   248                                                      
REMARK 465     LEU A   249                                                      
REMARK 465     ALA A   250                                                      
REMARK 465     SER A   251                                                      
REMARK 465     GLU A   252                                                      
REMARK 465     ALA A   253                                                      
REMARK 465     GLY A   254                                                      
REMARK 465     VAL A   255                                                      
REMARK 465     GLY A   281                                                      
REMARK 465     GLY A   282                                                      
REMARK 465     HIS A   283                                                      
REMARK 465     ARG A   284                                                      
REMARK 465     ASN A   438                                                      
REMARK 465     PRO A   439                                                      
REMARK 465     GLU A   440                                                      
REMARK 465     SER A   441                                                      
REMARK 465     GLY A   442                                                      
REMARK 465     ALA A   443                                                      
REMARK 465     MET A   444                                                      
REMARK 465     THR A   445                                                      
REMARK 465     SER A   446                                                      
REMARK 465     ILE A   464                                                      
REMARK 465     LYS A   465                                                      
REMARK 465     ASN A   466                                                      
REMARK 465     LYS A   467                                                      
REMARK 465     ALA A   468                                                      
REMARK 465     GLN A   469                                                      
REMARK 465     SER A   470                                                      
REMARK 465     VAL A   471                                                      
REMARK 465     GLY B   178                                                      
REMARK 465     GLN B   179                                                      
REMARK 465     SER B   180                                                      
REMARK 465     SER B   181                                                      
REMARK 465     SER B   182                                                      
REMARK 465     LEU B   183                                                      
REMARK 465     ALA B   184                                                      
REMARK 465     VAL B   185                                                      
REMARK 465     THR B   186                                                      
REMARK 465     LYS B   187                                                      
REMARK 465     THR B   188                                                      
REMARK 465     ASN B   189                                                      
REMARK 465     SER B   190                                                      
REMARK 465     ASP B   191                                                      
REMARK 465     ILE B   192                                                      
REMARK 465     LEU B   193                                                      
REMARK 465     PRO B   194                                                      
REMARK 465     PRO B   195                                                      
REMARK 465     GLN B   196                                                      
REMARK 465     LYS B   197                                                      
REMARK 465     LYS B   198                                                      
REMARK 465     THR B   199                                                      
REMARK 465     LYS B   200                                                      
REMARK 465     PRO B   201                                                      
REMARK 465     SER B   202                                                      
REMARK 465     GLN B   203                                                      
REMARK 465     LYS B   204                                                      
REMARK 465     VAL B   205                                                      
REMARK 465     GLN B   206                                                      
REMARK 465     GLY B   207                                                      
REMARK 465     ARG B   208                                                      
REMARK 465     GLY B   209                                                      
REMARK 465     SER B   210                                                      
REMARK 465     HIS B   211                                                      
REMARK 465     GLY B   212                                                      
REMARK 465     CYS B   213                                                      
REMARK 465     ARG B   214                                                      
REMARK 465     GLN B   215                                                      
REMARK 465     GLN B   216                                                      
REMARK 465     ARG B   217                                                      
REMARK 465     GLN B   218                                                      
REMARK 465     ALA B   219                                                      
REMARK 465     ARG B   220                                                      
REMARK 465     GLN B   221                                                      
REMARK 465     LYS B   222                                                      
REMARK 465     GLU B   223                                                      
REMARK 465     SER B   224                                                      
REMARK 465     THR B   225                                                      
REMARK 465     LEU B   226                                                      
REMARK 465     ARG B   227                                                      
REMARK 465     ARG B   228                                                      
REMARK 465     GLN B   229                                                      
REMARK 465     GLU B   230                                                      
REMARK 465     ARG B   231                                                      
REMARK 465     LYS B   232                                                      
REMARK 465     GLN B   330                                                      
REMARK 465     GLY B   331                                                      
REMARK 465     SER B   332                                                      
REMARK 465     LEU B   333                                                      
REMARK 465     ASP B   334                                                      
REMARK 465     SER B   335                                                      
REMARK 465     THR B   336                                                      
REMARK 465     MET B   337                                                      
REMARK 465     LYS B   338                                                      
REMARK 465     GLY B   339                                                      
REMARK 465     LYS B   340                                                      
REMARK 465     GLU B   341                                                      
REMARK 465     SER B   371                                                      
REMARK 465     ALA B   372                                                      
REMARK 465     GLN B   373                                                      
REMARK 465     ASN B   374                                                      
REMARK 465     PRO B   375                                                      
REMARK 465     PRO B   376                                                      
REMARK 465     ARG B   377                                                      
REMARK 465     ARG B   378                                                      
REMARK 465     GLY B   379                                                      
REMARK 465     LYS B   380                                                      
REMARK 465     GLN B   381                                                      
REMARK 465     GLY B   382                                                      
REMARK 465     ALA B   383                                                      
REMARK 465     ASN B   384                                                      
REMARK 465     LYS B   385                                                      
REMARK 465     GLN B   386                                                      
REMARK 465     THR B   387                                                      
REMARK 465     LYS B   388                                                      
REMARK 465     LYS B   389                                                      
REMARK 465     GLN B   390                                                      
REMARK 465     GLN B   391                                                      
REMARK 465     GLN B   392                                                      
REMARK 465     ARG B   393                                                      
REMARK 465     GLN B   394                                                      
REMARK 465     PRO B   395                                                      
REMARK 465     GLU B   396                                                      
REMARK 465     ALA B   397                                                      
REMARK 465     SER B   398                                                      
REMARK 465     ILE B   399                                                      
REMARK 465     GLY B   400                                                      
REMARK 465     SER B   401                                                      
REMARK 465     MET B   402                                                      
REMARK 465     GLY B   535                                                      
REMARK 465     GLU B   536                                                      
REMARK 465     GLY B   537                                                      
REMARK 465     VAL B   538                                                      
REMARK 465     THR B   539                                                      
REMARK 465     SER B   540                                                      
REMARK 465     ASP B   567                                                      
REMARK 465     SER B   568                                                      
REMARK 465     ALA B   569                                                      
REMARK 465     ASP B   570                                                      
REMARK 465     SER C   246                                                      
REMARK 465     ALA C   247                                                      
REMARK 465     GLU C   248                                                      
REMARK 465     LEU C   249                                                      
REMARK 465     ALA C   250                                                      
REMARK 465     SER C   251                                                      
REMARK 465     GLU C   252                                                      
REMARK 465     ALA C   253                                                      
REMARK 465     GLY C   254                                                      
REMARK 465     VAL C   255                                                      
REMARK 465     GLY C   281                                                      
REMARK 465     GLY C   282                                                      
REMARK 465     HIS C   283                                                      
REMARK 465     ARG C   284                                                      
REMARK 465     ASN C   438                                                      
REMARK 465     PRO C   439                                                      
REMARK 465     GLU C   440                                                      
REMARK 465     SER C   441                                                      
REMARK 465     GLY C   442                                                      
REMARK 465     ALA C   443                                                      
REMARK 465     MET C   444                                                      
REMARK 465     THR C   445                                                      
REMARK 465     SER C   446                                                      
REMARK 465     ILE C   464                                                      
REMARK 465     LYS C   465                                                      
REMARK 465     ASN C   466                                                      
REMARK 465     LYS C   467                                                      
REMARK 465     ALA C   468                                                      
REMARK 465     GLN C   469                                                      
REMARK 465     SER C   470                                                      
REMARK 465     VAL C   471                                                      
REMARK 465     GLY D   178                                                      
REMARK 465     GLN D   179                                                      
REMARK 465     SER D   180                                                      
REMARK 465     SER D   181                                                      
REMARK 465     SER D   182                                                      
REMARK 465     LEU D   183                                                      
REMARK 465     ALA D   184                                                      
REMARK 465     VAL D   185                                                      
REMARK 465     THR D   186                                                      
REMARK 465     LYS D   187                                                      
REMARK 465     THR D   188                                                      
REMARK 465     ASN D   189                                                      
REMARK 465     SER D   190                                                      
REMARK 465     ASP D   191                                                      
REMARK 465     ILE D   192                                                      
REMARK 465     LEU D   193                                                      
REMARK 465     PRO D   194                                                      
REMARK 465     PRO D   195                                                      
REMARK 465     GLN D   196                                                      
REMARK 465     LYS D   197                                                      
REMARK 465     LYS D   198                                                      
REMARK 465     THR D   199                                                      
REMARK 465     LYS D   200                                                      
REMARK 465     PRO D   201                                                      
REMARK 465     SER D   202                                                      
REMARK 465     GLN D   203                                                      
REMARK 465     LYS D   204                                                      
REMARK 465     VAL D   205                                                      
REMARK 465     GLN D   206                                                      
REMARK 465     GLY D   207                                                      
REMARK 465     ARG D   208                                                      
REMARK 465     GLY D   209                                                      
REMARK 465     SER D   210                                                      
REMARK 465     HIS D   211                                                      
REMARK 465     GLY D   212                                                      
REMARK 465     CYS D   213                                                      
REMARK 465     ARG D   214                                                      
REMARK 465     GLN D   215                                                      
REMARK 465     GLN D   216                                                      
REMARK 465     ARG D   217                                                      
REMARK 465     GLN D   218                                                      
REMARK 465     ALA D   219                                                      
REMARK 465     ARG D   220                                                      
REMARK 465     GLN D   221                                                      
REMARK 465     LYS D   222                                                      
REMARK 465     GLU D   223                                                      
REMARK 465     SER D   224                                                      
REMARK 465     THR D   225                                                      
REMARK 465     LEU D   226                                                      
REMARK 465     ARG D   227                                                      
REMARK 465     ARG D   228                                                      
REMARK 465     GLN D   229                                                      
REMARK 465     GLU D   230                                                      
REMARK 465     ARG D   231                                                      
REMARK 465     LYS D   232                                                      
REMARK 465     GLN D   330                                                      
REMARK 465     GLY D   331                                                      
REMARK 465     SER D   332                                                      
REMARK 465     LEU D   333                                                      
REMARK 465     ASP D   334                                                      
REMARK 465     SER D   335                                                      
REMARK 465     THR D   336                                                      
REMARK 465     MET D   337                                                      
REMARK 465     LYS D   338                                                      
REMARK 465     GLY D   339                                                      
REMARK 465     LYS D   340                                                      
REMARK 465     GLU D   341                                                      
REMARK 465     SER D   371                                                      
REMARK 465     ALA D   372                                                      
REMARK 465     GLN D   373                                                      
REMARK 465     ASN D   374                                                      
REMARK 465     PRO D   375                                                      
REMARK 465     PRO D   376                                                      
REMARK 465     ARG D   377                                                      
REMARK 465     ARG D   378                                                      
REMARK 465     GLY D   379                                                      
REMARK 465     LYS D   380                                                      
REMARK 465     GLN D   381                                                      
REMARK 465     GLY D   382                                                      
REMARK 465     ALA D   383                                                      
REMARK 465     ASN D   384                                                      
REMARK 465     LYS D   385                                                      
REMARK 465     GLN D   386                                                      
REMARK 465     THR D   387                                                      
REMARK 465     LYS D   388                                                      
REMARK 465     LYS D   389                                                      
REMARK 465     GLN D   390                                                      
REMARK 465     GLN D   391                                                      
REMARK 465     GLN D   392                                                      
REMARK 465     ARG D   393                                                      
REMARK 465     GLN D   394                                                      
REMARK 465     PRO D   395                                                      
REMARK 465     GLU D   396                                                      
REMARK 465     ALA D   397                                                      
REMARK 465     SER D   398                                                      
REMARK 465     ILE D   399                                                      
REMARK 465     GLY D   400                                                      
REMARK 465     SER D   401                                                      
REMARK 465     MET D   402                                                      
REMARK 465     GLY D   535                                                      
REMARK 465     GLU D   536                                                      
REMARK 465     GLY D   537                                                      
REMARK 465     VAL D   538                                                      
REMARK 465     THR D   539                                                      
REMARK 465     SER D   540                                                      
REMARK 465     ASP D   567                                                      
REMARK 465     SER D   568                                                      
REMARK 465     ALA D   569                                                      
REMARK 465     ASP D   570                                                      
REMARK 465     SER E   246                                                      
REMARK 465     ALA E   247                                                      
REMARK 465     GLU E   248                                                      
REMARK 465     LEU E   249                                                      
REMARK 465     ALA E   250                                                      
REMARK 465     SER E   251                                                      
REMARK 465     GLU E   252                                                      
REMARK 465     ALA E   253                                                      
REMARK 465     GLY E   254                                                      
REMARK 465     VAL E   255                                                      
REMARK 465     GLY E   281                                                      
REMARK 465     GLY E   282                                                      
REMARK 465     HIS E   283                                                      
REMARK 465     ARG E   284                                                      
REMARK 465     ASN E   438                                                      
REMARK 465     PRO E   439                                                      
REMARK 465     GLU E   440                                                      
REMARK 465     SER E   441                                                      
REMARK 465     GLY E   442                                                      
REMARK 465     ALA E   443                                                      
REMARK 465     MET E   444                                                      
REMARK 465     THR E   445                                                      
REMARK 465     SER E   446                                                      
REMARK 465     ILE E   464                                                      
REMARK 465     LYS E   465                                                      
REMARK 465     ASN E   466                                                      
REMARK 465     LYS E   467                                                      
REMARK 465     ALA E   468                                                      
REMARK 465     GLN E   469                                                      
REMARK 465     SER E   470                                                      
REMARK 465     VAL E   471                                                      
REMARK 465     GLY F   178                                                      
REMARK 465     GLN F   179                                                      
REMARK 465     SER F   180                                                      
REMARK 465     SER F   181                                                      
REMARK 465     SER F   182                                                      
REMARK 465     LEU F   183                                                      
REMARK 465     ALA F   184                                                      
REMARK 465     VAL F   185                                                      
REMARK 465     THR F   186                                                      
REMARK 465     LYS F   187                                                      
REMARK 465     THR F   188                                                      
REMARK 465     ASN F   189                                                      
REMARK 465     SER F   190                                                      
REMARK 465     ASP F   191                                                      
REMARK 465     ILE F   192                                                      
REMARK 465     LEU F   193                                                      
REMARK 465     PRO F   194                                                      
REMARK 465     PRO F   195                                                      
REMARK 465     GLN F   196                                                      
REMARK 465     LYS F   197                                                      
REMARK 465     LYS F   198                                                      
REMARK 465     THR F   199                                                      
REMARK 465     LYS F   200                                                      
REMARK 465     PRO F   201                                                      
REMARK 465     SER F   202                                                      
REMARK 465     GLN F   203                                                      
REMARK 465     LYS F   204                                                      
REMARK 465     VAL F   205                                                      
REMARK 465     GLN F   206                                                      
REMARK 465     GLY F   207                                                      
REMARK 465     ARG F   208                                                      
REMARK 465     GLY F   209                                                      
REMARK 465     SER F   210                                                      
REMARK 465     HIS F   211                                                      
REMARK 465     GLY F   212                                                      
REMARK 465     CYS F   213                                                      
REMARK 465     ARG F   214                                                      
REMARK 465     GLN F   215                                                      
REMARK 465     GLN F   216                                                      
REMARK 465     ARG F   217                                                      
REMARK 465     GLN F   218                                                      
REMARK 465     ALA F   219                                                      
REMARK 465     ARG F   220                                                      
REMARK 465     GLN F   221                                                      
REMARK 465     LYS F   222                                                      
REMARK 465     GLU F   223                                                      
REMARK 465     SER F   224                                                      
REMARK 465     THR F   225                                                      
REMARK 465     LEU F   226                                                      
REMARK 465     ARG F   227                                                      
REMARK 465     ARG F   228                                                      
REMARK 465     GLN F   229                                                      
REMARK 465     GLU F   230                                                      
REMARK 465     ARG F   231                                                      
REMARK 465     LYS F   232                                                      
REMARK 465     GLN F   330                                                      
REMARK 465     GLY F   331                                                      
REMARK 465     SER F   332                                                      
REMARK 465     LEU F   333                                                      
REMARK 465     ASP F   334                                                      
REMARK 465     SER F   335                                                      
REMARK 465     THR F   336                                                      
REMARK 465     MET F   337                                                      
REMARK 465     LYS F   338                                                      
REMARK 465     GLY F   339                                                      
REMARK 465     LYS F   340                                                      
REMARK 465     GLU F   341                                                      
REMARK 465     SER F   371                                                      
REMARK 465     ALA F   372                                                      
REMARK 465     GLN F   373                                                      
REMARK 465     ASN F   374                                                      
REMARK 465     PRO F   375                                                      
REMARK 465     PRO F   376                                                      
REMARK 465     ARG F   377                                                      
REMARK 465     ARG F   378                                                      
REMARK 465     GLY F   379                                                      
REMARK 465     LYS F   380                                                      
REMARK 465     GLN F   381                                                      
REMARK 465     GLY F   382                                                      
REMARK 465     ALA F   383                                                      
REMARK 465     ASN F   384                                                      
REMARK 465     LYS F   385                                                      
REMARK 465     GLN F   386                                                      
REMARK 465     THR F   387                                                      
REMARK 465     LYS F   388                                                      
REMARK 465     LYS F   389                                                      
REMARK 465     GLN F   390                                                      
REMARK 465     GLN F   391                                                      
REMARK 465     GLN F   392                                                      
REMARK 465     ARG F   393                                                      
REMARK 465     GLN F   394                                                      
REMARK 465     PRO F   395                                                      
REMARK 465     GLU F   396                                                      
REMARK 465     ALA F   397                                                      
REMARK 465     SER F   398                                                      
REMARK 465     ILE F   399                                                      
REMARK 465     GLY F   400                                                      
REMARK 465     SER F   401                                                      
REMARK 465     MET F   402                                                      
REMARK 465     GLY F   535                                                      
REMARK 465     GLU F   536                                                      
REMARK 465     GLY F   537                                                      
REMARK 465     VAL F   538                                                      
REMARK 465     THR F   539                                                      
REMARK 465     SER F   540                                                      
REMARK 465     ASP F   567                                                      
REMARK 465     SER F   568                                                      
REMARK 465     ALA F   569                                                      
REMARK 465     ASP F   570                                                      
REMARK 465     SER G   246                                                      
REMARK 465     ALA G   247                                                      
REMARK 465     GLU G   248                                                      
REMARK 465     LEU G   249                                                      
REMARK 465     ALA G   250                                                      
REMARK 465     SER G   251                                                      
REMARK 465     GLU G   252                                                      
REMARK 465     ALA G   253                                                      
REMARK 465     GLY G   254                                                      
REMARK 465     VAL G   255                                                      
REMARK 465     GLY G   281                                                      
REMARK 465     GLY G   282                                                      
REMARK 465     HIS G   283                                                      
REMARK 465     ARG G   284                                                      
REMARK 465     ASN G   438                                                      
REMARK 465     PRO G   439                                                      
REMARK 465     GLU G   440                                                      
REMARK 465     SER G   441                                                      
REMARK 465     GLY G   442                                                      
REMARK 465     ALA G   443                                                      
REMARK 465     MET G   444                                                      
REMARK 465     THR G   445                                                      
REMARK 465     SER G   446                                                      
REMARK 465     ILE G   464                                                      
REMARK 465     LYS G   465                                                      
REMARK 465     ASN G   466                                                      
REMARK 465     LYS G   467                                                      
REMARK 465     ALA G   468                                                      
REMARK 465     GLN G   469                                                      
REMARK 465     SER G   470                                                      
REMARK 465     VAL G   471                                                      
REMARK 465     GLY H   178                                                      
REMARK 465     GLN H   179                                                      
REMARK 465     SER H   180                                                      
REMARK 465     SER H   181                                                      
REMARK 465     SER H   182                                                      
REMARK 465     LEU H   183                                                      
REMARK 465     ALA H   184                                                      
REMARK 465     VAL H   185                                                      
REMARK 465     THR H   186                                                      
REMARK 465     LYS H   187                                                      
REMARK 465     THR H   188                                                      
REMARK 465     ASN H   189                                                      
REMARK 465     SER H   190                                                      
REMARK 465     ASP H   191                                                      
REMARK 465     ILE H   192                                                      
REMARK 465     LEU H   193                                                      
REMARK 465     PRO H   194                                                      
REMARK 465     PRO H   195                                                      
REMARK 465     GLN H   196                                                      
REMARK 465     LYS H   197                                                      
REMARK 465     LYS H   198                                                      
REMARK 465     THR H   199                                                      
REMARK 465     LYS H   200                                                      
REMARK 465     PRO H   201                                                      
REMARK 465     SER H   202                                                      
REMARK 465     GLN H   203                                                      
REMARK 465     LYS H   204                                                      
REMARK 465     VAL H   205                                                      
REMARK 465     GLN H   206                                                      
REMARK 465     GLY H   207                                                      
REMARK 465     ARG H   208                                                      
REMARK 465     GLY H   209                                                      
REMARK 465     SER H   210                                                      
REMARK 465     HIS H   211                                                      
REMARK 465     GLY H   212                                                      
REMARK 465     CYS H   213                                                      
REMARK 465     ARG H   214                                                      
REMARK 465     GLN H   215                                                      
REMARK 465     GLN H   216                                                      
REMARK 465     ARG H   217                                                      
REMARK 465     GLN H   218                                                      
REMARK 465     ALA H   219                                                      
REMARK 465     ARG H   220                                                      
REMARK 465     GLN H   221                                                      
REMARK 465     LYS H   222                                                      
REMARK 465     GLU H   223                                                      
REMARK 465     SER H   224                                                      
REMARK 465     THR H   225                                                      
REMARK 465     LEU H   226                                                      
REMARK 465     ARG H   227                                                      
REMARK 465     ARG H   228                                                      
REMARK 465     GLN H   229                                                      
REMARK 465     GLU H   230                                                      
REMARK 465     ARG H   231                                                      
REMARK 465     LYS H   232                                                      
REMARK 465     GLN H   330                                                      
REMARK 465     GLY H   331                                                      
REMARK 465     SER H   332                                                      
REMARK 465     LEU H   333                                                      
REMARK 465     ASP H   334                                                      
REMARK 465     SER H   335                                                      
REMARK 465     THR H   336                                                      
REMARK 465     MET H   337                                                      
REMARK 465     LYS H   338                                                      
REMARK 465     GLY H   339                                                      
REMARK 465     LYS H   340                                                      
REMARK 465     GLU H   341                                                      
REMARK 465     SER H   371                                                      
REMARK 465     ALA H   372                                                      
REMARK 465     GLN H   373                                                      
REMARK 465     ASN H   374                                                      
REMARK 465     PRO H   375                                                      
REMARK 465     PRO H   376                                                      
REMARK 465     ARG H   377                                                      
REMARK 465     ARG H   378                                                      
REMARK 465     GLY H   379                                                      
REMARK 465     LYS H   380                                                      
REMARK 465     GLN H   381                                                      
REMARK 465     GLY H   382                                                      
REMARK 465     ALA H   383                                                      
REMARK 465     ASN H   384                                                      
REMARK 465     LYS H   385                                                      
REMARK 465     GLN H   386                                                      
REMARK 465     THR H   387                                                      
REMARK 465     LYS H   388                                                      
REMARK 465     LYS H   389                                                      
REMARK 465     GLN H   390                                                      
REMARK 465     GLN H   391                                                      
REMARK 465     GLN H   392                                                      
REMARK 465     ARG H   393                                                      
REMARK 465     GLN H   394                                                      
REMARK 465     PRO H   395                                                      
REMARK 465     GLU H   396                                                      
REMARK 465     ALA H   397                                                      
REMARK 465     SER H   398                                                      
REMARK 465     ILE H   399                                                      
REMARK 465     GLY H   400                                                      
REMARK 465     SER H   401                                                      
REMARK 465     MET H   402                                                      
REMARK 465     GLY H   535                                                      
REMARK 465     GLU H   536                                                      
REMARK 465     GLY H   537                                                      
REMARK 465     VAL H   538                                                      
REMARK 465     THR H   539                                                      
REMARK 465     SER H   540                                                      
REMARK 465     ASP H   567                                                      
REMARK 465     SER H   568                                                      
REMARK 465     ALA H   569                                                      
REMARK 465     ASP H   570                                                      
REMARK 465      DT J    22                                                      
REMARK 465      DC J    34                                                      
REMARK 465      DG J    35                                                      
REMARK 465      DG J    36                                                      
REMARK 465      DG J    37                                                      
REMARK 465      DC L    56                                                      
REMARK 465      DA L    57                                                      
REMARK 465      DT L    58                                                      
REMARK 465      DT L    59                                                      
REMARK 465      DT N    22                                                      
REMARK 465      DC N    34                                                      
REMARK 465      DG N    35                                                      
REMARK 465      DG N    36                                                      
REMARK 465      DG N    37                                                      
REMARK 465      DC P    56                                                      
REMARK 465      DA P    57                                                      
REMARK 465      DT P    58                                                      
REMARK 465      DT P    59                                                      
REMARK 465      DT R    22                                                      
REMARK 465      DC R    34                                                      
REMARK 465      DG R    35                                                      
REMARK 465      DG R    36                                                      
REMARK 465      DG R    37                                                      
REMARK 465      DC T    56                                                      
REMARK 465      DA T    57                                                      
REMARK 465      DT T    58                                                      
REMARK 465      DT T    59                                                      
REMARK 465      DT V    22                                                      
REMARK 465      DC V    34                                                      
REMARK 465      DG V    35                                                      
REMARK 465      DG V    36                                                      
REMARK 465      DG V    37                                                      
REMARK 465      DC X    56                                                      
REMARK 465      DA X    57                                                      
REMARK 465      DT X    58                                                      
REMARK 465      DT X    59                                                      
REMARK 470                                                                      
REMARK 470 MISSING ATOM                                                         
REMARK 470 THE FOLLOWING RESIDUES HAVE MISSING ATOMS (M=MODEL NUMBER;           
REMARK 470 RES=RESIDUE NAME; C=CHAIN IDENTIFIER; SSEQ=SEQUENCE NUMBER;          
REMARK 470 I=INSERTION CODE):                                                   
REMARK 470   M RES CSSEQI  ATOMS                                                
REMARK 470     GLY A 533    O                                                   
REMARK 470     GLY C 533    O                                                   
REMARK 470     GLY E 533    O                                                   
REMARK 470     GLY G 533    O                                                   
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: CLOSE CONTACTS IN SAME ASYMMETRIC UNIT                     
REMARK 500                                                                      
REMARK 500 THE FOLLOWING ATOMS ARE IN CLOSE CONTACT.                            
REMARK 500                                                                      
REMARK 500  ATM1  RES C  SSEQI   ATM2  RES C  SSEQI           DISTANCE          
REMARK 500   NH2  ARG G   538     O    LEU H   473              1.87            
REMARK 500   NH1  ARG E   401     OE1  GLN F   424              1.91            
REMARK 500   NH1  ARG C   401     OE1  GLN D   424              1.93            
REMARK 500   NH1  ARG B   534     OP1   DG L    50              1.97            
REMARK 500   NH2  ARG E   477     OE1  GLN F   488              1.97            
REMARK 500   NH1  ARG E   431     O    GLY E   434              1.98            
REMARK 500   NH2  ARG F   491     OP1   DG R    45              1.99            
REMARK 500   OG1  THR H   541     O5'   DG P    50              1.99            
REMARK 500   NZ   LYS F   449     OP2   DA Q     2              1.99            
REMARK 500   N6    DA V    44     O4    DT X    49              2.00            
REMARK 500   O    GLU B   309     NZ   LYS B   357              2.03            
REMARK 500   O    GLU H   309     NZ   LYS H   357              2.04            
REMARK 500   O    GLU D   309     NZ   LYS D   357              2.10            
REMARK 500   OG   SER C   486     OP1   DC V    30              2.10            
REMARK 500   NZ   LYS G   489     OP1   DC N    30              2.10            
REMARK 500   NH1  ARG C   431     O    GLY C   434              2.10            
REMARK 500   NZ   LYS A   489     OP1   DC J    30              2.11            
REMARK 500   NH1  ARG A   431     O    GLY A   434              2.11            
REMARK 500   ND2  ASN C   531     OP2   DT U    10              2.13            
REMARK 500   O    LEU B   432     OG1  THR B   436              2.14            
REMARK 500   NH1  ARG H   534     OP1   DG P    50              2.14            
REMARK 500   OG1  THR A   499     O    THR B   559              2.15            
REMARK 500   O    LEU F   432     OG1  THR F   436              2.15            
REMARK 500   O    VAL D   287     OG   SER D   290              2.16            
REMARK 500   N    ARG A   472     O    PRO B   562              2.17            
REMARK 500   O6    DG M     9     N6    DA N    25              2.17            
REMARK 500   ND2  ASN E   390     OP1   DA Q     2              2.18            
REMARK 500   O6    DG Q     7     N6    DA R    27              2.18            
REMARK 500   O2    DC J    43     N2    DG L    50              2.19            
REMARK 500   N2    DG N    45     O2    DT P    49              2.19            
REMARK 500   O    LEU H   432     OG1  THR H   436              2.19            
REMARK 500   O    VAL H   287     OG   SER H   290              2.19            
REMARK 500   OH   TYR A   411     OE1  GLN B   416              2.19            
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: CLOSE CONTACTS                                             
REMARK 500                                                                      
REMARK 500 THE FOLLOWING ATOMS THAT ARE RELATED BY CRYSTALLOGRAPHIC             
REMARK 500 SYMMETRY ARE IN CLOSE CONTACT.  AN ATOM LOCATED WITHIN 0.15          
REMARK 500 ANGSTROMS OF A SYMMETRY RELATED ATOM IS ASSUMED TO BE ON A           
REMARK 500 SPECIAL POSITION AND IS, THEREFORE, LISTED IN REMARK 375             
REMARK 500 INSTEAD OF REMARK 500.  ATOMS WITH NON-BLANK ALTERNATE               
REMARK 500 LOCATION INDICATORS ARE NOT INCLUDED IN THE CALCULATIONS.            
REMARK 500                                                                      
REMARK 500 DISTANCE CUTOFF:                                                     
REMARK 500 2.2 ANGSTROMS FOR CONTACTS NOT INVOLVING HYDROGEN ATOMS              
REMARK 500 1.6 ANGSTROMS FOR CONTACTS INVOLVING HYDROGEN ATOMS                  
REMARK 500                                                                      
REMARK 500  ATM1  RES C  SSEQI   ATM2  RES C  SSEQI  SSYMOP   DISTANCE          
REMARK 500   OE1  GLN A   424     NE2  GLN D   516     8555     2.11            
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: COVALENT BOND LENGTHS                                      
REMARK 500                                                                      
REMARK 500 THE STEREOCHEMICAL PARAMETERS OF THE FOLLOWING RESIDUES              
REMARK 500 HAVE VALUES WHICH DEVIATE FROM EXPECTED VALUES BY MORE               
REMARK 500 THAN 6*RMSD (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 500 IDENTIFIER; SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                 
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT: (10X,I3,1X,2(A3,1X,A1,I4,A1,1X,A4,3X),1X,F6.3)               
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES PROTEIN: ENGH AND HUBER, 1999                        
REMARK 500 EXPECTED VALUES NUCLEIC ACID: CLOWNEY ET AL 1996                     
REMARK 500                                                                      
REMARK 500  M RES CSSEQI ATM1   RES CSSEQI ATM2   DEVIATION                     
REMARK 500    GLU B 409   CB    GLU B 409   CG      0.120                       
REMARK 500    GLU B 409   CG    GLU B 409   CD      0.110                       
REMARK 500    TRP D 293   CB    TRP D 293   CG     -0.127                       
REMARK 500    ILE D 486   CA    ILE D 486   CB      0.173                       
REMARK 500    TRP F 293   CB    TRP F 293   CG     -0.116                       
REMARK 500    GLU F 409   CB    GLU F 409   CG      0.157                       
REMARK 500    GLU F 409   CG    GLU F 409   CD      0.116                       
REMARK 500    GLU F 431   CG    GLU F 431   CD      0.091                       
REMARK 500    CYS G 359   CB    CYS G 359   SG     -0.136                       
REMARK 500    TYR G 366   CB    TYR G 366   CG      0.102                       
REMARK 500    PHE G 398   CB    PHE G 398   CG      0.104                       
REMARK 500    TRP H 293   CB    TRP H 293   CG     -0.111                       
REMARK 500    GLU H 409   CB    GLU H 409   CG      0.116                       
REMARK 500    GLU H 409   CG    GLU H 409   CD      0.116                       
REMARK 500     DG I   7   O3'    DG I   7   C3'    -0.044                       
REMARK 500     DT I   8   O3'    DT I   8   C3'    -0.041                       
REMARK 500     DA J  40   O3'    DA J  40   C3'     0.091                       
REMARK 500     DT L  47   O3'    DT L  47   C3'     0.094                       
REMARK 500     DC L  48   C1'    DC L  48   N1      0.093                       
REMARK 500     DG L  50   O3'    DG L  50   C3'     0.080                       
REMARK 500     DT P  47   C1'    DT P  47   N1      0.089                       
REMARK 500     DT P  49   N3     DT P  49   C4      0.054                       
REMARK 500     DT P  49   C5     DT P  49   C6      0.053                       
REMARK 500     DT P  49   C6     DT P  49   N1      0.047                       
REMARK 500     DT P  49   C5     DT P  49   C7      0.047                       
REMARK 500     DT P  53   C5'    DT P  53   C4'     0.042                       
REMARK 500     DC T  48   C1'    DC T  48   N1      0.098                       
REMARK 500     DG T  50   O3'    DG T  50   C3'     0.090                       
REMARK 500     DT T  55   C1'    DT T  55   N1      0.102                       
REMARK 500     DA V  38   C5'    DA V  38   C4'     0.049                       
REMARK 500     DA V  38   N9     DA V  38   C4      0.045                       
REMARK 500     DA V  40   O3'    DA V  40   C3'    -0.054                       
REMARK 500     DA V  44   C5'    DA V  44   C4'     0.047                       
REMARK 500     DT X  47   C1'    DT X  47   N1      0.107                       
REMARK 500     DG X  50   O3'    DG X  50   C3'    -0.036                       
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: COVALENT BOND ANGLES                                       
REMARK 500                                                                      
REMARK 500 THE STEREOCHEMICAL PARAMETERS OF THE FOLLOWING RESIDUES              
REMARK 500 HAVE VALUES WHICH DEVIATE FROM EXPECTED VALUES BY MORE               
REMARK 500 THAN 6*RMSD (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN               
REMARK 500 IDENTIFIER; SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                 
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT: (10X,I3,1X,A3,1X,A1,I4,A1,3(1X,A4,2X),12X,F5.1)              
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES PROTEIN: ENGH AND HUBER, 1999                        
REMARK 500 EXPECTED VALUES NUCLEIC ACID: CLOWNEY ET AL 1996                     
REMARK 500                                                                      
REMARK 500  M RES CSSEQI ATM1   ATM2   ATM3                                     
REMARK 500    LEU A 288   CA  -  CB  -  CG  ANGL. DEV. =  15.0 DEGREES          
REMARK 500    LEU A 294   CA  -  CB  -  CG  ANGL. DEV. = -14.9 DEGREES          
REMARK 500    LEU A 415   CA  -  CB  -  CG  ANGL. DEV. =  15.5 DEGREES          
REMARK 500    PRO A 436   C   -  N   -  CA  ANGL. DEV. =   9.2 DEGREES          
REMARK 500    CYS A 451   CA  -  CB  -  SG  ANGL. DEV. =   6.6 DEGREES          
REMARK 500    LEU B 249   CA  -  CB  -  CG  ANGL. DEV. =  26.6 DEGREES          
REMARK 500    CYS B 289   CA  -  CB  -  SG  ANGL. DEV. =   9.2 DEGREES          
REMARK 500    CYS B 437   CA  -  CB  -  SG  ANGL. DEV. =   8.9 DEGREES          
REMARK 500    CYS B 460   CA  -  CB  -  SG  ANGL. DEV. =   8.3 DEGREES          
REMARK 500    LEU B 461   CA  -  CB  -  CG  ANGL. DEV. =  16.8 DEGREES          
REMARK 500    LEU B 489   CA  -  CB  -  CG  ANGL. DEV. = -14.9 DEGREES          
REMARK 500    SER B 542   N   -  CA  -  C   ANGL. DEV. = -19.3 DEGREES          
REMARK 500    LEU B 560   CA  -  CB  -  CG  ANGL. DEV. =  16.1 DEGREES          
REMARK 500    LEU C 288   CA  -  CB  -  CG  ANGL. DEV. =  14.7 DEGREES          
REMARK 500    LEU C 294   CA  -  CB  -  CG  ANGL. DEV. = -14.4 DEGREES          
REMARK 500    LEU C 356   CB  -  CG  -  CD2 ANGL. DEV. =  13.9 DEGREES          
REMARK 500    PRO C 436   C   -  N   -  CA  ANGL. DEV. =   9.6 DEGREES          
REMARK 500    LEU D 249   CA  -  CB  -  CG  ANGL. DEV. =  23.8 DEGREES          
REMARK 500    CYS D 289   CA  -  CB  -  SG  ANGL. DEV. =  12.4 DEGREES          
REMARK 500    LEU D 417   CA  -  CB  -  CG  ANGL. DEV. = -13.9 DEGREES          
REMARK 500    CYS D 437   CA  -  CB  -  SG  ANGL. DEV. =   8.8 DEGREES          
REMARK 500    LEU D 461   CA  -  CB  -  CG  ANGL. DEV. =  15.5 DEGREES          
REMARK 500    LEU D 489   CA  -  CB  -  CG  ANGL. DEV. = -19.3 DEGREES          
REMARK 500    SER D 542   N   -  CA  -  C   ANGL. DEV. = -20.2 DEGREES          
REMARK 500    LEU D 560   CA  -  CB  -  CG  ANGL. DEV. =  15.7 DEGREES          
REMARK 500    LEU E 288   CA  -  CB  -  CG  ANGL. DEV. =  14.9 DEGREES          
REMARK 500    LEU E 294   CA  -  CB  -  CG  ANGL. DEV. = -14.6 DEGREES          
REMARK 500    LEU E 356   CB  -  CG  -  CD2 ANGL. DEV. =  12.6 DEGREES          
REMARK 500    LEU E 412   CA  -  CB  -  CG  ANGL. DEV. =  15.2 DEGREES          
REMARK 500    LEU E 415   CA  -  CB  -  CG  ANGL. DEV. =  15.2 DEGREES          
REMARK 500    PRO E 432   C   -  N   -  CA  ANGL. DEV. =  10.6 DEGREES          
REMARK 500    LEU F 249   CA  -  CB  -  CG  ANGL. DEV. =  23.0 DEGREES          
REMARK 500    CYS F 289   CA  -  CB  -  SG  ANGL. DEV. =  12.1 DEGREES          
REMARK 500    LEU F 417   CA  -  CB  -  CG  ANGL. DEV. = -15.1 DEGREES          
REMARK 500    GLU F 431   CA  -  CB  -  CG  ANGL. DEV. =  13.5 DEGREES          
REMARK 500    CYS F 437   CA  -  CB  -  SG  ANGL. DEV. =  10.2 DEGREES          
REMARK 500    CYS F 460   CA  -  CB  -  SG  ANGL. DEV. =   6.8 DEGREES          
REMARK 500    LEU F 461   CA  -  CB  -  CG  ANGL. DEV. =  15.1 DEGREES          
REMARK 500    LEU F 489   CA  -  CB  -  CG  ANGL. DEV. = -15.1 DEGREES          
REMARK 500    SER F 542   N   -  CA  -  C   ANGL. DEV. = -18.7 DEGREES          
REMARK 500    LEU G 356   CB  -  CG  -  CD2 ANGL. DEV. =  15.2 DEGREES          
REMARK 500    LEU H 249   CA  -  CB  -  CG  ANGL. DEV. =  27.2 DEGREES          
REMARK 500    CYS H 289   CA  -  CB  -  SG  ANGL. DEV. =  10.3 DEGREES          
REMARK 500    CYS H 437   CA  -  CB  -  SG  ANGL. DEV. =   8.4 DEGREES          
REMARK 500    CYS H 460   CA  -  CB  -  SG  ANGL. DEV. =   7.7 DEGREES          
REMARK 500    LEU H 461   CA  -  CB  -  CG  ANGL. DEV. =  16.1 DEGREES          
REMARK 500    LEU H 461   CB  -  CG  -  CD2 ANGL. DEV. =  11.4 DEGREES          
REMARK 500    LEU H 489   CA  -  CB  -  CG  ANGL. DEV. = -15.1 DEGREES          
REMARK 500    SER H 542   N   -  CA  -  C   ANGL. DEV. = -19.6 DEGREES          
REMARK 500    LEU H 560   CA  -  CB  -  CG  ANGL. DEV. =  14.3 DEGREES          
REMARK 500                                                                      
REMARK 500 THIS ENTRY HAS     261 ANGLE DEVIATIONS.                             
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 500                                                                      
REMARK 500 GEOMETRY AND STEREOCHEMISTRY                                         
REMARK 500 SUBTOPIC: TORSION ANGLES                                             
REMARK 500                                                                      
REMARK 500 TORSION ANGLES OUTSIDE THE EXPECTED RAMACHANDRAN REGIONS:            
REMARK 500 (M=MODEL NUMBER; RES=RESIDUE NAME; C=CHAIN IDENTIFIER;               
REMARK 500 SSEQ=SEQUENCE NUMBER; I=INSERTION CODE).                             
REMARK 500                                                                      
REMARK 500 STANDARD TABLE:                                                      
REMARK 500 FORMAT:(10X,I3,1X,A3,1X,A1,I4,A1,4X,F7.2,3X,F7.2)                    
REMARK 500                                                                      
REMARK 500 EXPECTED VALUES: GJ KLEYWEGT AND TA JONES (1996). PHI/PSI-           
REMARK 500 CHOLOGY: RAMACHANDRAN REVISITED. STRUCTURE 4, 1395 - 1400            
REMARK 500                                                                      
REMARK 500  M RES CSSEQI        PSI       PHI                                   
REMARK 500    PRO A 259      108.64    -34.63                                   
REMARK 500    GLU A 370       79.69     64.35                                   
REMARK 500    ASN A 376       32.87    -78.46                                   
REMARK 500    PRO A 432      -95.02    -61.00                                   
REMARK 500    TRP A 433       26.53   -143.14                                   
REMARK 500    GLU A 473      -54.89    -24.79                                   
REMARK 500    MET A 480       37.90    -89.09                                   
REMARK 500    ALA B 297      -61.17   -122.41                                   
REMARK 500    PRO B 310       42.29    -74.06                                   
REMARK 500    GLU B 367      -70.51   -157.19                                   
REMARK 500    SER B 463     -118.96     48.72                                   
REMARK 500    ALA B 474     -155.52    -82.72                                   
REMARK 500    PRO B 505       17.45    -68.35                                   
REMARK 500    PRO C 259      109.54    -33.53                                   
REMARK 500    GLU C 370       80.42     63.81                                   
REMARK 500    ASN C 376       48.86    -95.25                                   
REMARK 500    PRO C 432     -102.10    -61.61                                   
REMARK 500    MET C 480       38.61    -90.05                                   
REMARK 500    PRO C 549      163.51    -39.90                                   
REMARK 500    ALA D 297      -61.74   -122.25                                   
REMARK 500    PRO D 310       42.07    -74.94                                   
REMARK 500    GLU D 367      -70.30   -156.66                                   
REMARK 500    SER D 463     -123.91     48.95                                   
REMARK 500    ALA D 474     -156.29    -82.40                                   
REMARK 500    PRO D 505       17.19    -68.69                                   
REMARK 500    PRO E 259      109.37    -33.65                                   
REMARK 500    GLU E 370       79.98     63.84                                   
REMARK 500    ASN E 376       48.64    -95.56                                   
REMARK 500    PRO E 432     -101.88    -61.94                                   
REMARK 500    GLU E 473      -54.89    -29.17                                   
REMARK 500    MET E 480       38.02    -88.53                                   
REMARK 500    ALA F 297      -61.41   -122.21                                   
REMARK 500    PRO F 310       42.48    -74.76                                   
REMARK 500    GLU F 367      -70.16   -156.60                                   
REMARK 500    SER F 463     -122.51     50.82                                   
REMARK 500    ALA F 474     -156.15    -82.65                                   
REMARK 500    PRO F 505       17.03    -68.82                                   
REMARK 500    PRO G 259      105.91    -36.12                                   
REMARK 500    GLU G 370       79.60     63.80                                   
REMARK 500    ASN G 376       49.09    -95.60                                   
REMARK 500    PRO G 432      -92.18    -65.51                                   
REMARK 500    TRP G 433       28.58   -145.04                                   
REMARK 500    MET G 480       37.84    -89.84                                   
REMARK 500    PRO G 549      162.85    -38.70                                   
REMARK 500    ALA H 297      -61.09   -122.45                                   
REMARK 500    PRO H 310       42.20    -74.21                                   
REMARK 500    GLU H 367      -70.89   -157.17                                   
REMARK 500    SER H 463     -120.80     48.95                                   
REMARK 500    ALA H 474     -155.46    -82.90                                   
REMARK 500    PRO H 505       17.56    -68.18                                   
REMARK 500                                                                      
REMARK 500 REMARK: NULL                                                         
REMARK 900                                                                      
REMARK 900 RELATED ENTRIES                                                      
REMARK 900 RELATED ID: 4P0P   RELATED DB: PDB                                   
REMARK 900 RELATED ID: 4P0Q   RELATED DB: PDB                                   
REMARK 900 RELATED ID: 4P0R   RELATED DB: PDB                                   
DBREF  4P0S A  246   551  UNP    Q96NY9   MUS81_HUMAN    246    551             
DBREF  4P0S B  178   570  UNP    Q96AY2   EME1_HUMAN     178    570             
DBREF  4P0S C  246   551  UNP    Q96NY9   MUS81_HUMAN    246    551             
DBREF  4P0S D  178   570  UNP    Q96AY2   EME1_HUMAN     178    570             
DBREF  4P0S E  246   551  UNP    Q96NY9   MUS81_HUMAN    246    551             
DBREF  4P0S F  178   570  UNP    Q96AY2   EME1_HUMAN     178    570             
DBREF  4P0S G  246   551  UNP    Q96NY9   MUS81_HUMAN    246    551             
DBREF  4P0S H  178   570  UNP    Q96AY2   EME1_HUMAN     178    570             
DBREF  4P0S I    1    12  PDB    4P0S     4P0S             1     12             
DBREF  4P0S J   22    45  PDB    4P0S     4P0S            22     45             
DBREF  4P0S L   47    59  PDB    4P0S     4P0S            47     59             
DBREF  4P0S M    1    12  PDB    4P0S     4P0S             1     12             
DBREF  4P0S N   22    45  PDB    4P0S     4P0S            22     45             
DBREF  4P0S P   47    59  PDB    4P0S     4P0S            47     59             
DBREF  4P0S Q    1    12  PDB    4P0S     4P0S             1     12             
DBREF  4P0S R   22    45  PDB    4P0S     4P0S            22     45             
DBREF  4P0S T   47    59  PDB    4P0S     4P0S            47     59             
DBREF  4P0S U    1    12  PDB    4P0S     4P0S             1     12             
DBREF  4P0S V   22    45  PDB    4P0S     4P0S            22     45             
DBREF  4P0S X   47    59  PDB    4P0S     4P0S            47     59             
SEQRES   1 A  306  SER ALA GLU LEU ALA SER GLU ALA GLY VAL GLN GLN GLN          
SEQRES   2 A  306  PRO LEU GLU LEU ARG PRO GLY GLU TYR ARG VAL LEU LEU          
SEQRES   3 A  306  CYS VAL ASP ILE GLY GLU THR ARG GLY GLY GLY HIS ARG          
SEQRES   4 A  306  PRO GLU LEU LEU ARG GLU LEU GLN ARG LEU HIS VAL THR          
SEQRES   5 A  306  HIS THR VAL ARG LYS LEU HIS VAL GLY ASP PHE VAL TRP          
SEQRES   6 A  306  VAL ALA GLN GLU THR ASN PRO ARG ASP PRO ALA ASN PRO          
SEQRES   7 A  306  GLY GLU LEU VAL LEU ASP HIS ILE VAL GLU ARG LYS ARG          
SEQRES   8 A  306  LEU ASP ASP LEU CYS SER SER ILE ILE ASP GLY ARG PHE          
SEQRES   9 A  306  ARG GLU GLN LYS PHE ARG LEU LYS ARG CYS GLY LEU GLU          
SEQRES  10 A  306  ARG ARG VAL TYR LEU VAL GLU GLU HIS GLY SER VAL HIS          
SEQRES  11 A  306  ASN LEU SER LEU PRO GLU SER THR LEU LEU GLN ALA VAL          
SEQRES  12 A  306  THR ASN THR GLN VAL ILE ASP GLY PHE PHE VAL LYS ARG          
SEQRES  13 A  306  THR ALA ASP ILE LYS GLU SER ALA ALA TYR LEU ALA LEU          
SEQRES  14 A  306  LEU THR ARG GLY LEU GLN ARG LEU TYR GLN GLY HIS THR          
SEQRES  15 A  306  LEU ARG SER ARG PRO TRP GLY THR PRO GLY ASN PRO GLU          
SEQRES  16 A  306  SER GLY ALA MET THR SER PRO ASN PRO LEU CYS SER LEU          
SEQRES  17 A  306  LEU THR PHE SER ASP PHE ASN ALA GLY ALA ILE LYS ASN          
SEQRES  18 A  306  LYS ALA GLN SER VAL ARG GLU VAL PHE ALA ARG GLN LEU          
SEQRES  19 A  306  MET GLN VAL ARG GLY VAL SER GLY GLU LYS ALA ALA ALA          
SEQRES  20 A  306  LEU VAL ASP ARG TYR SER THR PRO ALA SER LEU LEU ALA          
SEQRES  21 A  306  ALA TYR ASP ALA CYS ALA THR PRO LYS GLU GLN GLU THR          
SEQRES  22 A  306  LEU LEU SER THR ILE LYS CYS GLY ARG LEU GLN ARG ASN          
SEQRES  23 A  306  LEU GLY PRO ALA LEU SER ARG THR LEU SER GLN LEU TYR          
SEQRES  24 A  306  CYS SER TYR GLY PRO LEU THR                                  
SEQRES   1 B  393  GLY GLN SER SER SER LEU ALA VAL THR LYS THR ASN SER          
SEQRES   2 B  393  ASP ILE LEU PRO PRO GLN LYS LYS THR LYS PRO SER GLN          
SEQRES   3 B  393  LYS VAL GLN GLY ARG GLY SER HIS GLY CYS ARG GLN GLN          
SEQRES   4 B  393  ARG GLN ALA ARG GLN LYS GLU SER THR LEU ARG ARG GLN          
SEQRES   5 B  393  GLU ARG LYS ASN ALA ALA LEU VAL THR ARG MET LYS ALA          
SEQRES   6 B  393  GLN ARG PRO GLU GLU CYS LEU LYS HIS ILE ILE VAL VAL          
SEQRES   7 B  393  LEU ASP PRO VAL LEU LEU GLN MET GLU GLY GLY GLY GLN          
SEQRES   8 B  393  LEU LEU GLY ALA LEU GLN THR MET GLU CYS ARG CYS VAL          
SEQRES   9 B  393  ILE GLU ALA GLN ALA VAL PRO CYS SER VAL THR TRP ARG          
SEQRES  10 B  393  ARG ARG ALA GLY PRO SER GLU ASP ARG GLU ASP TRP VAL          
SEQRES  11 B  393  GLU GLU PRO THR VAL LEU VAL LEU LEU ARG ALA GLU ALA          
SEQRES  12 B  393  PHE VAL SER MET ILE ASP ASN GLY LYS GLN GLY SER LEU          
SEQRES  13 B  393  ASP SER THR MET LYS GLY LYS GLU THR LEU GLN GLY PHE          
SEQRES  14 B  393  VAL THR ASP ILE THR ALA LYS THR ALA GLY LYS ALA LEU          
SEQRES  15 B  393  SER LEU VAL ILE VAL ASP GLN GLU LYS CYS PHE SER ALA          
SEQRES  16 B  393  GLN ASN PRO PRO ARG ARG GLY LYS GLN GLY ALA ASN LYS          
SEQRES  17 B  393  GLN THR LYS LYS GLN GLN GLN ARG GLN PRO GLU ALA SER          
SEQRES  18 B  393  ILE GLY SER MET VAL SER ARG VAL ASP ALA GLU GLU ALA          
SEQRES  19 B  393  LEU VAL ASP LEU GLN LEU HIS THR GLU ALA GLN ALA GLN          
SEQRES  20 B  393  ILE VAL GLN SER TRP LYS GLU LEU ALA ASP PHE THR CYS          
SEQRES  21 B  393  ALA PHE THR LYS ALA VAL ALA GLU ALA PRO PHE LYS LYS          
SEQRES  22 B  393  LEU ARG ASP GLU THR THR PHE SER PHE CYS LEU GLU SER          
SEQRES  23 B  393  ASP TRP ALA GLY GLY VAL LYS VAL ASP LEU ALA GLY ARG          
SEQRES  24 B  393  GLY LEU ALA LEU VAL TRP ARG ARG GLN ILE GLN GLN LEU          
SEQRES  25 B  393  ASN ARG VAL SER LEU GLU MET ALA SER ALA VAL VAL ASN          
SEQRES  26 B  393  ALA TYR PRO SER PRO GLN LEU LEU VAL GLN ALA TYR GLN          
SEQRES  27 B  393  GLN CYS PHE SER ASP LYS GLU ARG GLN ASN LEU LEU ALA          
SEQRES  28 B  393  ASP ILE GLN VAL ARG ARG GLY GLU GLY VAL THR SER THR          
SEQRES  29 B  393  SER ARG ARG ILE GLY PRO GLU LEU SER ARG ARG ILE TYR          
SEQRES  30 B  393  LEU GLN MET THR THR LEU GLN PRO HIS LEU SER LEU ASP          
SEQRES  31 B  393  SER ALA ASP                                                  
SEQRES   1 C  306  SER ALA GLU LEU ALA SER GLU ALA GLY VAL GLN GLN GLN          
SEQRES   2 C  306  PRO LEU GLU LEU ARG PRO GLY GLU TYR ARG VAL LEU LEU          
SEQRES   3 C  306  CYS VAL ASP ILE GLY GLU THR ARG GLY GLY GLY HIS ARG          
SEQRES   4 C  306  PRO GLU LEU LEU ARG GLU LEU GLN ARG LEU HIS VAL THR          
SEQRES   5 C  306  HIS THR VAL ARG LYS LEU HIS VAL GLY ASP PHE VAL TRP          
SEQRES   6 C  306  VAL ALA GLN GLU THR ASN PRO ARG ASP PRO ALA ASN PRO          
SEQRES   7 C  306  GLY GLU LEU VAL LEU ASP HIS ILE VAL GLU ARG LYS ARG          
SEQRES   8 C  306  LEU ASP ASP LEU CYS SER SER ILE ILE ASP GLY ARG PHE          
SEQRES   9 C  306  ARG GLU GLN LYS PHE ARG LEU LYS ARG CYS GLY LEU GLU          
SEQRES  10 C  306  ARG ARG VAL TYR LEU VAL GLU GLU HIS GLY SER VAL HIS          
SEQRES  11 C  306  ASN LEU SER LEU PRO GLU SER THR LEU LEU GLN ALA VAL          
SEQRES  12 C  306  THR ASN THR GLN VAL ILE ASP GLY PHE PHE VAL LYS ARG          
SEQRES  13 C  306  THR ALA ASP ILE LYS GLU SER ALA ALA TYR LEU ALA LEU          
SEQRES  14 C  306  LEU THR ARG GLY LEU GLN ARG LEU TYR GLN GLY HIS THR          
SEQRES  15 C  306  LEU ARG SER ARG PRO TRP GLY THR PRO GLY ASN PRO GLU          
SEQRES  16 C  306  SER GLY ALA MET THR SER PRO ASN PRO LEU CYS SER LEU          
SEQRES  17 C  306  LEU THR PHE SER ASP PHE ASN ALA GLY ALA ILE LYS ASN          
SEQRES  18 C  306  LYS ALA GLN SER VAL ARG GLU VAL PHE ALA ARG GLN LEU          
SEQRES  19 C  306  MET GLN VAL ARG GLY VAL SER GLY GLU LYS ALA ALA ALA          
SEQRES  20 C  306  LEU VAL ASP ARG TYR SER THR PRO ALA SER LEU LEU ALA          
SEQRES  21 C  306  ALA TYR ASP ALA CYS ALA THR PRO LYS GLU GLN GLU THR          
SEQRES  22 C  306  LEU LEU SER THR ILE LYS CYS GLY ARG LEU GLN ARG ASN          
SEQRES  23 C  306  LEU GLY PRO ALA LEU SER ARG THR LEU SER GLN LEU TYR          
SEQRES  24 C  306  CYS SER TYR GLY PRO LEU THR                                  
SEQRES   1 D  393  GLY GLN SER SER SER LEU ALA VAL THR LYS THR ASN SER          
SEQRES   2 D  393  ASP ILE LEU PRO PRO GLN LYS LYS THR LYS PRO SER GLN          
SEQRES   3 D  393  LYS VAL GLN GLY ARG GLY SER HIS GLY CYS ARG GLN GLN          
SEQRES   4 D  393  ARG GLN ALA ARG GLN LYS GLU SER THR LEU ARG ARG GLN          
SEQRES   5 D  393  GLU ARG LYS ASN ALA ALA LEU VAL THR ARG MET LYS ALA          
SEQRES   6 D  393  GLN ARG PRO GLU GLU CYS LEU LYS HIS ILE ILE VAL VAL          
SEQRES   7 D  393  LEU ASP PRO VAL LEU LEU GLN MET GLU GLY GLY GLY GLN          
SEQRES   8 D  393  LEU LEU GLY ALA LEU GLN THR MET GLU CYS ARG CYS VAL          
SEQRES   9 D  393  ILE GLU ALA GLN ALA VAL PRO CYS SER VAL THR TRP ARG          
SEQRES  10 D  393  ARG ARG ALA GLY PRO SER GLU ASP ARG GLU ASP TRP VAL          
SEQRES  11 D  393  GLU GLU PRO THR VAL LEU VAL LEU LEU ARG ALA GLU ALA          
SEQRES  12 D  393  PHE VAL SER MET ILE ASP ASN GLY LYS GLN GLY SER LEU          
SEQRES  13 D  393  ASP SER THR MET LYS GLY LYS GLU THR LEU GLN GLY PHE          
SEQRES  14 D  393  VAL THR ASP ILE THR ALA LYS THR ALA GLY LYS ALA LEU          
SEQRES  15 D  393  SER LEU VAL ILE VAL ASP GLN GLU LYS CYS PHE SER ALA          
SEQRES  16 D  393  GLN ASN PRO PRO ARG ARG GLY LYS GLN GLY ALA ASN LYS          
SEQRES  17 D  393  GLN THR LYS LYS GLN GLN GLN ARG GLN PRO GLU ALA SER          
SEQRES  18 D  393  ILE GLY SER MET VAL SER ARG VAL ASP ALA GLU GLU ALA          
SEQRES  19 D  393  LEU VAL ASP LEU GLN LEU HIS THR GLU ALA GLN ALA GLN          
SEQRES  20 D  393  ILE VAL GLN SER TRP LYS GLU LEU ALA ASP PHE THR CYS          
SEQRES  21 D  393  ALA PHE THR LYS ALA VAL ALA GLU ALA PRO PHE LYS LYS          
SEQRES  22 D  393  LEU ARG ASP GLU THR THR PHE SER PHE CYS LEU GLU SER          
SEQRES  23 D  393  ASP TRP ALA GLY GLY VAL LYS VAL ASP LEU ALA GLY ARG          
SEQRES  24 D  393  GLY LEU ALA LEU VAL TRP ARG ARG GLN ILE GLN GLN LEU          
SEQRES  25 D  393  ASN ARG VAL SER LEU GLU MET ALA SER ALA VAL VAL ASN          
SEQRES  26 D  393  ALA TYR PRO SER PRO GLN LEU LEU VAL GLN ALA TYR GLN          
SEQRES  27 D  393  GLN CYS PHE SER ASP LYS GLU ARG GLN ASN LEU LEU ALA          
SEQRES  28 D  393  ASP ILE GLN VAL ARG ARG GLY GLU GLY VAL THR SER THR          
SEQRES  29 D  393  SER ARG ARG ILE GLY PRO GLU LEU SER ARG ARG ILE TYR          
SEQRES  30 D  393  LEU GLN MET THR THR LEU GLN PRO HIS LEU SER LEU ASP          
SEQRES  31 D  393  SER ALA ASP                                                  
SEQRES   1 E  306  SER ALA GLU LEU ALA SER GLU ALA GLY VAL GLN GLN GLN          
SEQRES   2 E  306  PRO LEU GLU LEU ARG PRO GLY GLU TYR ARG VAL LEU LEU          
SEQRES   3 E  306  CYS VAL ASP ILE GLY GLU THR ARG GLY GLY GLY HIS ARG          
SEQRES   4 E  306  PRO GLU LEU LEU ARG GLU LEU GLN ARG LEU HIS VAL THR          
SEQRES   5 E  306  HIS THR VAL ARG LYS LEU HIS VAL GLY ASP PHE VAL TRP          
SEQRES   6 E  306  VAL ALA GLN GLU THR ASN PRO ARG ASP PRO ALA ASN PRO          
SEQRES   7 E  306  GLY GLU LEU VAL LEU ASP HIS ILE VAL GLU ARG LYS ARG          
SEQRES   8 E  306  LEU ASP ASP LEU CYS SER SER ILE ILE ASP GLY ARG PHE          
SEQRES   9 E  306  ARG GLU GLN LYS PHE ARG LEU LYS ARG CYS GLY LEU GLU          
SEQRES  10 E  306  ARG ARG VAL TYR LEU VAL GLU GLU HIS GLY SER VAL HIS          
SEQRES  11 E  306  ASN LEU SER LEU PRO GLU SER THR LEU LEU GLN ALA VAL          
SEQRES  12 E  306  THR ASN THR GLN VAL ILE ASP GLY PHE PHE VAL LYS ARG          
SEQRES  13 E  306  THR ALA ASP ILE LYS GLU SER ALA ALA TYR LEU ALA LEU          
SEQRES  14 E  306  LEU THR ARG GLY LEU GLN ARG LEU TYR GLN GLY HIS THR          
SEQRES  15 E  306  LEU ARG SER ARG PRO TRP GLY THR PRO GLY ASN PRO GLU          
SEQRES  16 E  306  SER GLY ALA MET THR SER PRO ASN PRO LEU CYS SER LEU          
SEQRES  17 E  306  LEU THR PHE SER ASP PHE ASN ALA GLY ALA ILE LYS ASN          
SEQRES  18 E  306  LYS ALA GLN SER VAL ARG GLU VAL PHE ALA ARG GLN LEU          
SEQRES  19 E  306  MET GLN VAL ARG GLY VAL SER GLY GLU LYS ALA ALA ALA          
SEQRES  20 E  306  LEU VAL ASP ARG TYR SER THR PRO ALA SER LEU LEU ALA          
SEQRES  21 E  306  ALA TYR ASP ALA CYS ALA THR PRO LYS GLU GLN GLU THR          
SEQRES  22 E  306  LEU LEU SER THR ILE LYS CYS GLY ARG LEU GLN ARG ASN          
SEQRES  23 E  306  LEU GLY PRO ALA LEU SER ARG THR LEU SER GLN LEU TYR          
SEQRES  24 E  306  CYS SER TYR GLY PRO LEU THR                                  
SEQRES   1 F  393  GLY GLN SER SER SER LEU ALA VAL THR LYS THR ASN SER          
SEQRES   2 F  393  ASP ILE LEU PRO PRO GLN LYS LYS THR LYS PRO SER GLN          
SEQRES   3 F  393  LYS VAL GLN GLY ARG GLY SER HIS GLY CYS ARG GLN GLN          
SEQRES   4 F  393  ARG GLN ALA ARG GLN LYS GLU SER THR LEU ARG ARG GLN          
SEQRES   5 F  393  GLU ARG LYS ASN ALA ALA LEU VAL THR ARG MET LYS ALA          
SEQRES   6 F  393  GLN ARG PRO GLU GLU CYS LEU LYS HIS ILE ILE VAL VAL          
SEQRES   7 F  393  LEU ASP PRO VAL LEU LEU GLN MET GLU GLY GLY GLY GLN          
SEQRES   8 F  393  LEU LEU GLY ALA LEU GLN THR MET GLU CYS ARG CYS VAL          
SEQRES   9 F  393  ILE GLU ALA GLN ALA VAL PRO CYS SER VAL THR TRP ARG          
SEQRES  10 F  393  ARG ARG ALA GLY PRO SER GLU ASP ARG GLU ASP TRP VAL          
SEQRES  11 F  393  GLU GLU PRO THR VAL LEU VAL LEU LEU ARG ALA GLU ALA          
SEQRES  12 F  393  PHE VAL SER MET ILE ASP ASN GLY LYS GLN GLY SER LEU          
SEQRES  13 F  393  ASP SER THR MET LYS GLY LYS GLU THR LEU GLN GLY PHE          
SEQRES  14 F  393  VAL THR ASP ILE THR ALA LYS THR ALA GLY LYS ALA LEU          
SEQRES  15 F  393  SER LEU VAL ILE VAL ASP GLN GLU LYS CYS PHE SER ALA          
SEQRES  16 F  393  GLN ASN PRO PRO ARG ARG GLY LYS GLN GLY ALA ASN LYS          
SEQRES  17 F  393  GLN THR LYS LYS GLN GLN GLN ARG GLN PRO GLU ALA SER          
SEQRES  18 F  393  ILE GLY SER MET VAL SER ARG VAL ASP ALA GLU GLU ALA          
SEQRES  19 F  393  LEU VAL ASP LEU GLN LEU HIS THR GLU ALA GLN ALA GLN          
SEQRES  20 F  393  ILE VAL GLN SER TRP LYS GLU LEU ALA ASP PHE THR CYS          
SEQRES  21 F  393  ALA PHE THR LYS ALA VAL ALA GLU ALA PRO PHE LYS LYS          
SEQRES  22 F  393  LEU ARG ASP GLU THR THR PHE SER PHE CYS LEU GLU SER          
SEQRES  23 F  393  ASP TRP ALA GLY GLY VAL LYS VAL ASP LEU ALA GLY ARG          
SEQRES  24 F  393  GLY LEU ALA LEU VAL TRP ARG ARG GLN ILE GLN GLN LEU          
SEQRES  25 F  393  ASN ARG VAL SER LEU GLU MET ALA SER ALA VAL VAL ASN          
SEQRES  26 F  393  ALA TYR PRO SER PRO GLN LEU LEU VAL GLN ALA TYR GLN          
SEQRES  27 F  393  GLN CYS PHE SER ASP LYS GLU ARG GLN ASN LEU LEU ALA          
SEQRES  28 F  393  ASP ILE GLN VAL ARG ARG GLY GLU GLY VAL THR SER THR          
SEQRES  29 F  393  SER ARG ARG ILE GLY PRO GLU LEU SER ARG ARG ILE TYR          
SEQRES  30 F  393  LEU GLN MET THR THR LEU GLN PRO HIS LEU SER LEU ASP          
SEQRES  31 F  393  SER ALA ASP                                                  
SEQRES   1 G  306  SER ALA GLU LEU ALA SER GLU ALA GLY VAL GLN GLN GLN          
SEQRES   2 G  306  PRO LEU GLU LEU ARG PRO GLY GLU TYR ARG VAL LEU LEU          
SEQRES   3 G  306  CYS VAL ASP ILE GLY GLU THR ARG GLY GLY GLY HIS ARG          
SEQRES   4 G  306  PRO GLU LEU LEU ARG GLU LEU GLN ARG LEU HIS VAL THR          
SEQRES   5 G  306  HIS THR VAL ARG LYS LEU HIS VAL GLY ASP PHE VAL TRP          
SEQRES   6 G  306  VAL ALA GLN GLU THR ASN PRO ARG ASP PRO ALA ASN PRO          
SEQRES   7 G  306  GLY GLU LEU VAL LEU ASP HIS ILE VAL GLU ARG LYS ARG          
SEQRES   8 G  306  LEU ASP ASP LEU CYS SER SER ILE ILE ASP GLY ARG PHE          
SEQRES   9 G  306  ARG GLU GLN LYS PHE ARG LEU LYS ARG CYS GLY LEU GLU          
SEQRES  10 G  306  ARG ARG VAL TYR LEU VAL GLU GLU HIS GLY SER VAL HIS          
SEQRES  11 G  306  ASN LEU SER LEU PRO GLU SER THR LEU LEU GLN ALA VAL          
SEQRES  12 G  306  THR ASN THR GLN VAL ILE ASP GLY PHE PHE VAL LYS ARG          
SEQRES  13 G  306  THR ALA ASP ILE LYS GLU SER ALA ALA TYR LEU ALA LEU          
SEQRES  14 G  306  LEU THR ARG GLY LEU GLN ARG LEU TYR GLN GLY HIS THR          
SEQRES  15 G  306  LEU ARG SER ARG PRO TRP GLY THR PRO GLY ASN PRO GLU          
SEQRES  16 G  306  SER GLY ALA MET THR SER PRO ASN PRO LEU CYS SER LEU          
SEQRES  17 G  306  LEU THR PHE SER ASP PHE ASN ALA GLY ALA ILE LYS ASN          
SEQRES  18 G  306  LYS ALA GLN SER VAL ARG GLU VAL PHE ALA ARG GLN LEU          
SEQRES  19 G  306  MET GLN VAL ARG GLY VAL SER GLY GLU LYS ALA ALA ALA          
SEQRES  20 G  306  LEU VAL ASP ARG TYR SER THR PRO ALA SER LEU LEU ALA          
SEQRES  21 G  306  ALA TYR ASP ALA CYS ALA THR PRO LYS GLU GLN GLU THR          
SEQRES  22 G  306  LEU LEU SER THR ILE LYS CYS GLY ARG LEU GLN ARG ASN          
SEQRES  23 G  306  LEU GLY PRO ALA LEU SER ARG THR LEU SER GLN LEU TYR          
SEQRES  24 G  306  CYS SER TYR GLY PRO LEU THR                                  
SEQRES   1 H  393  GLY GLN SER SER SER LEU ALA VAL THR LYS THR ASN SER          
SEQRES   2 H  393  ASP ILE LEU PRO PRO GLN LYS LYS THR LYS PRO SER GLN          
SEQRES   3 H  393  LYS VAL GLN GLY ARG GLY SER HIS GLY CYS ARG GLN GLN          
SEQRES   4 H  393  ARG GLN ALA ARG GLN LYS GLU SER THR LEU ARG ARG GLN          
SEQRES   5 H  393  GLU ARG LYS ASN ALA ALA LEU VAL THR ARG MET LYS ALA          
SEQRES   6 H  393  GLN ARG PRO GLU GLU CYS LEU LYS HIS ILE ILE VAL VAL          
SEQRES   7 H  393  LEU ASP PRO VAL LEU LEU GLN MET GLU GLY GLY GLY GLN          
SEQRES   8 H  393  LEU LEU GLY ALA LEU GLN THR MET GLU CYS ARG CYS VAL          
SEQRES   9 H  393  ILE GLU ALA GLN ALA VAL PRO CYS SER VAL THR TRP ARG          
SEQRES  10 H  393  ARG ARG ALA GLY PRO SER GLU ASP ARG GLU ASP TRP VAL          
SEQRES  11 H  393  GLU GLU PRO THR VAL LEU VAL LEU LEU ARG ALA GLU ALA          
SEQRES  12 H  393  PHE VAL SER MET ILE ASP ASN GLY LYS GLN GLY SER LEU          
SEQRES  13 H  393  ASP SER THR MET LYS GLY LYS GLU THR LEU GLN GLY PHE          
SEQRES  14 H  393  VAL THR ASP ILE THR ALA LYS THR ALA GLY LYS ALA LEU          
SEQRES  15 H  393  SER LEU VAL ILE VAL ASP GLN GLU LYS CYS PHE SER ALA          
SEQRES  16 H  393  GLN ASN PRO PRO ARG ARG GLY LYS GLN GLY ALA ASN LYS          
SEQRES  17 H  393  GLN THR LYS LYS GLN GLN GLN ARG GLN PRO GLU ALA SER          
SEQRES  18 H  393  ILE GLY SER MET VAL SER ARG VAL ASP ALA GLU GLU ALA          
SEQRES  19 H  393  LEU VAL ASP LEU GLN LEU HIS THR GLU ALA GLN ALA GLN          
SEQRES  20 H  393  ILE VAL GLN SER TRP LYS GLU LEU ALA ASP PHE THR CYS          
SEQRES  21 H  393  ALA PHE THR LYS ALA VAL ALA GLU ALA PRO PHE LYS LYS          
SEQRES  22 H  393  LEU ARG ASP GLU THR THR PHE SER PHE CYS LEU GLU SER          
SEQRES  23 H  393  ASP TRP ALA GLY GLY VAL LYS VAL ASP LEU ALA GLY ARG          
SEQRES  24 H  393  GLY LEU ALA LEU VAL TRP ARG ARG GLN ILE GLN GLN LEU          
SEQRES  25 H  393  ASN ARG VAL SER LEU GLU MET ALA SER ALA VAL VAL ASN          
SEQRES  26 H  393  ALA TYR PRO SER PRO GLN LEU LEU VAL GLN ALA TYR GLN          
SEQRES  27 H  393  GLN CYS PHE SER ASP LYS GLU ARG GLN ASN LEU LEU ALA          
SEQRES  28 H  393  ASP ILE GLN VAL ARG ARG GLY GLU GLY VAL THR SER THR          
SEQRES  29 H  393  SER ARG ARG ILE GLY PRO GLU LEU SER ARG ARG ILE TYR          
SEQRES  30 H  393  LEU GLN MET THR THR LEU GLN PRO HIS LEU SER LEU ASP          
SEQRES  31 H  393  SER ALA ASP                                                  
SEQRES   1 I   12   DG  DA  DA  DT  DG  DT  DG  DT  DG  DT  DC  DT              
SEQRES   1 J   24   DT  DA  DG  DA  DC  DA  DC  DA  DC  DA  DT  DT  DC          
SEQRES   2 J   24   DG  DG  DG  DA  DC  DA  DT  DG  DC  DA  DG                  
SEQRES   1 L   13   DT  DC  DT  DG  DC  DA  DT  DG  DT  DC  DA  DT  DT          
SEQRES   1 M   12   DG  DA  DA  DT  DG  DT  DG  DT  DG  DT  DC  DT              
SEQRES   1 N   24   DT  DA  DG  DA  DC  DA  DC  DA  DC  DA  DT  DT  DC          
SEQRES   2 N   24   DG  DG  DG  DA  DC  DA  DT  DG  DC  DA  DG                  
SEQRES   1 P   13   DT  DC  DT  DG  DC  DA  DT  DG  DT  DC  DA  DT  DT          
SEQRES   1 Q   12   DG  DA  DA  DT  DG  DT  DG  DT  DG  DT  DC  DT              
SEQRES   1 R   24   DT  DA  DG  DA  DC  DA  DC  DA  DC  DA  DT  DT  DC          
SEQRES   2 R   24   DG  DG  DG  DA  DC  DA  DT  DG  DC  DA  DG                  
SEQRES   1 T   13   DT  DC  DT  DG  DC  DA  DT  DG  DT  DC  DA  DT  DT          
SEQRES   1 U   12   DG  DA  DA  DT  DG  DT  DG  DT  DG  DT  DC  DT              
SEQRES   1 V   24   DT  DA  DG  DA  DC  DA  DC  DA  DC  DA  DT  DT  DC          
SEQRES   2 V   24   DG  DG  DG  DA  DC  DA  DT  DG  DC  DA  DG                  
SEQRES   1 X   13   DT  DC  DT  DG  DC  DA  DT  DG  DT  DC  DA  DT  DT          
HELIX    1 AA1 GLU A  286  LEU A  294  1                                   9    
HELIX    2 AA2 ARG A  336  ASP A  346  1                                  11    
HELIX    3 AA3 GLY A  347  ARG A  358  1                                  12    
HELIX    4 AA4 PRO A  380  ILE A  394  1                                  15    
HELIX    5 AA5 ASP A  404  TYR A  423  1                                  20    
HELIX    6 AA6 PHE A  456  ALA A  463  1                                   8    
HELIX    7 AA7 GLU A  473  MET A  480  1                                   8    
HELIX    8 AA8 SER A  486  TYR A  497  1                                  12    
HELIX    9 AA9 THR A  499  CYS A  510  1                                  12    
HELIX   10 AB1 THR A  512  THR A  518  1                                   7    
HELIX   11 AB2 PRO A  534  SER A  546  1                                  13    
HELIX   12 AB3 THR B  238  ALA B  242  5                                   5    
HELIX   13 AB4 GLU B  247  LYS B  250  5                                   4    
HELIX   14 AB5 ASP B  257  GLN B  262  1                                   6    
HELIX   15 AB6 GLY B  265  THR B  275  1                                  11    
HELIX   16 AB7 ALA B  318  LYS B  329  1                                  12    
HELIX   17 AB8 LEU B  343  ALA B  355  1                                  13    
HELIX   18 AB9 SER B  404  THR B  419  1                                  16    
HELIX   19 AC1 SER B  428  THR B  456  1                                  29    
HELIX   20 AC2 PHE B  457  GLU B  462  5                                   6    
HELIX   21 AC3 GLY B  477  GLN B  488  1                                  12    
HELIX   22 AC4 SER B  493  TYR B  504  1                                  12    
HELIX   23 AC5 SER B  506  GLN B  516  1                                  11    
HELIX   24 AC6 GLY B  546  THR B  559  1                                  14    
HELIX   25 AC7 GLU C  286  LEU C  294  1                                   9    
HELIX   26 AC8 ARG C  336  ASP C  346  1                                  11    
HELIX   27 AC9 GLY C  347  ARG C  358  1                                  12    
HELIX   28 AD1 PRO C  380  ILE C  394  1                                  15    
HELIX   29 AD2 ASP C  404  TYR C  423  1                                  20    
HELIX   30 AD3 PHE C  456  GLY C  462  1                                   7    
HELIX   31 AD4 GLU C  473  MET C  480  1                                   8    
HELIX   32 AD5 SER C  486  TYR C  497  1                                  12    
HELIX   33 AD6 THR C  499  CYS C  510  1                                  12    
HELIX   34 AD7 THR C  512  THR C  518  1                                   7    
HELIX   35 AD8 ALA C  535  CYS C  545  1                                  11    
HELIX   36 AD9 GLU D  247  LYS D  250  5                                   4    
HELIX   37 AE1 ASP D  257  GLN D  262  1                                   6    
HELIX   38 AE2 GLY D  265  THR D  275  1                                  11    
HELIX   39 AE3 ALA D  318  LYS D  329  1                                  12    
HELIX   40 AE4 LEU D  343  ALA D  355  1                                  13    
HELIX   41 AE5 SER D  404  THR D  419  1                                  16    
HELIX   42 AE6 SER D  428  THR D  456  1                                  29    
HELIX   43 AE7 PHE D  457  LEU D  461  5                                   5    
HELIX   44 AE8 GLY D  477  GLN D  488  1                                  12    
HELIX   45 AE9 SER D  493  TYR D  504  1                                  12    
HELIX   46 AF1 SER D  506  GLN D  516  1                                  11    
HELIX   47 AF2 GLY D  546  THR D  559  1                                  14    
HELIX   48 AF3 GLU E  286  LEU E  294  1                                   9    
HELIX   49 AF4 ARG E  336  ASP E  346  1                                  11    
HELIX   50 AF5 GLY E  347  ARG E  358  1                                  12    
HELIX   51 AF6 PRO E  380  ILE E  394  1                                  15    
HELIX   52 AF7 ASP E  404  TYR E  423  1                                  20    
HELIX   53 AF8 PHE E  456  ALA E  463  1                                   8    
HELIX   54 AF9 GLU E  473  MET E  480  1                                   8    
HELIX   55 AG1 SER E  486  TYR E  497  1                                  12    
HELIX   56 AG2 THR E  499  CYS E  510  1                                  12    
HELIX   57 AG3 THR E  512  THR E  518  1                                   7    
HELIX   58 AG4 PRO E  534  SER E  546  1                                  13    
HELIX   59 AG5 GLU F  247  LYS F  250  5                                   4    
HELIX   60 AG6 ASP F  257  GLN F  262  1                                   6    
HELIX   61 AG7 GLY F  265  THR F  275  1                                  11    
HELIX   62 AG8 ALA F  318  LYS F  329  1                                  12    
HELIX   63 AG9 LEU F  343  ALA F  355  1                                  13    
HELIX   64 AH1 SER F  404  THR F  419  1                                  16    
HELIX   65 AH2 SER F  428  THR F  456  1                                  29    
HELIX   66 AH3 PHE F  457  LEU F  461  5                                   5    
HELIX   67 AH4 GLY F  477  GLN F  488  1                                  12    
HELIX   68 AH5 SER F  493  TYR F  504  1                                  12    
HELIX   69 AH6 SER F  506  GLN F  516  1                                  11    
HELIX   70 AH7 GLY F  546  THR F  559  1                                  14    
HELIX   71 AH8 GLU G  286  LEU G  294  1                                   9    
HELIX   72 AH9 ARG G  336  ASP G  346  1                                  11    
HELIX   73 AI1 GLY G  347  ARG G  358  1                                  12    
HELIX   74 AI2 PRO G  380  ILE G  394  1                                  15    
HELIX   75 AI3 ASP G  404  TYR G  423  1                                  20    
HELIX   76 AI4 PHE G  456  GLY G  462  1                                   7    
HELIX   77 AI5 GLU G  473  MET G  480  1                                   8    
HELIX   78 AI6 SER G  486  TYR G  497  1                                  12    
HELIX   79 AI7 THR G  499  CYS G  510  1                                  12    
HELIX   80 AI8 THR G  512  THR G  518  1                                   7    
HELIX   81 AI9 PRO G  534  SER G  546  1                                  13    
HELIX   82 AJ1 GLU H  247  LYS H  250  5                                   4    
HELIX   83 AJ2 ASP H  257  GLN H  262  1                                   6    
HELIX   84 AJ3 GLY H  265  THR H  275  1                                  11    
HELIX   85 AJ4 ALA H  318  LYS H  329  1                                  12    
HELIX   86 AJ5 LEU H  343  ALA H  355  1                                  13    
HELIX   87 AJ6 SER H  404  THR H  419  1                                  16    
HELIX   88 AJ7 SER H  428  THR H  456  1                                  29    
HELIX   89 AJ8 PHE H  457  GLU H  462  5                                   6    
HELIX   90 AJ9 GLY H  477  GLN H  488  1                                  12    
HELIX   91 AK1 SER H  493  TYR H  504  1                                  12    
HELIX   92 AK2 SER H  506  GLN H  516  1                                  11    
HELIX   93 AK3 GLY H  546  THR H  559  1                                  14    
SHEET    1 AA1 7 GLU A 261  LEU A 262  0                                        
SHEET    2 AA1 7 LEU A 428  ARG A 431 -1  O  LEU A 428   N  LEU A 262           
SHEET    3 AA1 7 SER A 452  THR A 455  1  O  LEU A 453   N  ARG A 429           
SHEET    4 AA1 7 GLU A 325  LYS A 335 -1  N  VAL A 327   O  LEU A 454           
SHEET    5 AA1 7 PHE A 308  GLU A 314 -1  N  TRP A 310   O  LEU A 328           
SHEET    6 AA1 7 TYR A 267  ASP A 274 -1  N  CYS A 272   O  VAL A 309           
SHEET    7 AA1 7 HIS A 298  ARG A 301  1  O  THR A 299   N  LEU A 271           
SHEET    1 AA2 6 GLU A 261  LEU A 262  0                                        
SHEET    2 AA2 6 LEU A 428  ARG A 431 -1  O  LEU A 428   N  LEU A 262           
SHEET    3 AA2 6 SER A 452  THR A 455  1  O  LEU A 453   N  ARG A 429           
SHEET    4 AA2 6 GLU A 325  LYS A 335 -1  N  VAL A 327   O  LEU A 454           
SHEET    5 AA2 6 ARG A 363  VAL A 368  1  O  LEU A 367   N  LYS A 335           
SHEET    6 AA2 6 PHE A 398  ARG A 401  1  O  PHE A 398   N  TYR A 366           
SHEET    1 AA3 4 CYS B 280  ILE B 282  0                                        
SHEET    2 AA3 4 ILE B 252  LEU B 256  1  N  LEU B 256   O  VAL B 281           
SHEET    3 AA3 4 SER B 290  ARG B 295 -1  O  ARG B 294   N  ILE B 253           
SHEET    4 AA3 4 VAL B 307  GLU B 308 -1  O  VAL B 307   N  ARG B 295           
SHEET    1 AA4 6 CYS B 280  ILE B 282  0                                        
SHEET    2 AA4 6 ILE B 252  LEU B 256  1  N  LEU B 256   O  VAL B 281           
SHEET    3 AA4 6 SER B 290  ARG B 295 -1  O  ARG B 294   N  ILE B 253           
SHEET    4 AA4 6 THR B 311  ARG B 317 -1  O  LEU B 313   N  VAL B 291           
SHEET    5 AA4 6 ALA B 358  VAL B 364  1  O  VAL B 362   N  LEU B 316           
SHEET    6 AA4 6 GLN B 422  VAL B 426  1  O  GLN B 422   N  LEU B 361           
SHEET    1 AA5 7 GLU C 261  LEU C 262  0                                        
SHEET    2 AA5 7 LEU C 428  ARG C 431 -1  O  LEU C 428   N  LEU C 262           
SHEET    3 AA5 7 SER C 452  THR C 455  1  O  LEU C 453   N  ARG C 429           
SHEET    4 AA5 7 GLU C 325  LYS C 335 -1  N  VAL C 327   O  LEU C 454           
SHEET    5 AA5 7 PHE C 308  GLU C 314 -1  N  TRP C 310   O  LEU C 328           
SHEET    6 AA5 7 TYR C 267  ASP C 274 -1  N  CYS C 272   O  VAL C 309           
SHEET    7 AA5 7 HIS C 298  ARG C 301  1  O  THR C 299   N  LEU C 271           
SHEET    1 AA6 6 GLU C 261  LEU C 262  0                                        
SHEET    2 AA6 6 LEU C 428  ARG C 431 -1  O  LEU C 428   N  LEU C 262           
SHEET    3 AA6 6 SER C 452  THR C 455  1  O  LEU C 453   N  ARG C 429           
SHEET    4 AA6 6 GLU C 325  LYS C 335 -1  N  VAL C 327   O  LEU C 454           
SHEET    5 AA6 6 ARG C 363  VAL C 368  1  O  LEU C 367   N  LYS C 335           
SHEET    6 AA6 6 PHE C 398  ARG C 401  1  O  PHE C 398   N  TYR C 366           
SHEET    1 AA7 4 CYS D 280  ILE D 282  0                                        
SHEET    2 AA7 4 ILE D 252  LEU D 256  1  N  LEU D 256   O  VAL D 281           
SHEET    3 AA7 4 SER D 290  ARG D 295 -1  O  ARG D 294   N  ILE D 253           
SHEET    4 AA7 4 VAL D 307  GLU D 308 -1  O  VAL D 307   N  ARG D 295           
SHEET    1 AA8 6 CYS D 280  ILE D 282  0                                        
SHEET    2 AA8 6 ILE D 252  LEU D 256  1  N  LEU D 256   O  VAL D 281           
SHEET    3 AA8 6 SER D 290  ARG D 295 -1  O  ARG D 294   N  ILE D 253           
SHEET    4 AA8 6 THR D 311  ARG D 317 -1  O  LEU D 313   N  VAL D 291           
SHEET    5 AA8 6 ALA D 358  VAL D 364  1  O  VAL D 362   N  LEU D 316           
SHEET    6 AA8 6 GLN D 422  VAL D 426  1  O  GLN D 422   N  LEU D 361           
SHEET    1 AA9 7 GLU E 261  LEU E 262  0                                        
SHEET    2 AA9 7 LEU E 428  ARG E 431 -1  O  LEU E 428   N  LEU E 262           
SHEET    3 AA9 7 SER E 452  THR E 455  1  O  LEU E 453   N  ARG E 429           
SHEET    4 AA9 7 GLU E 325  LYS E 335 -1  N  VAL E 327   O  LEU E 454           
SHEET    5 AA9 7 PHE E 308  GLU E 314 -1  N  TRP E 310   O  LEU E 328           
SHEET    6 AA9 7 TYR E 267  ASP E 274 -1  N  CYS E 272   O  VAL E 309           
SHEET    7 AA9 7 HIS E 298  ARG E 301  1  O  THR E 299   N  LEU E 271           
SHEET    1 AB1 6 GLU E 261  LEU E 262  0                                        
SHEET    2 AB1 6 LEU E 428  ARG E 431 -1  O  LEU E 428   N  LEU E 262           
SHEET    3 AB1 6 SER E 452  THR E 455  1  O  LEU E 453   N  ARG E 429           
SHEET    4 AB1 6 GLU E 325  LYS E 335 -1  N  VAL E 327   O  LEU E 454           
SHEET    5 AB1 6 ARG E 363  VAL E 368  1  O  LEU E 367   N  LYS E 335           
SHEET    6 AB1 6 PHE E 398  ARG E 401  1  O  PHE E 398   N  TYR E 366           
SHEET    1 AB2 2 LYS E 524  CYS E 525  0                                        
SHEET    2 AB2 2 ARG E 530  ASN E 531 -1  O  ARG E 530   N  CYS E 525           
SHEET    1 AB3 4 CYS F 280  ILE F 282  0                                        
SHEET    2 AB3 4 ILE F 252  LEU F 256  1  N  LEU F 256   O  VAL F 281           
SHEET    3 AB3 4 SER F 290  ARG F 295 -1  O  ARG F 294   N  ILE F 253           
SHEET    4 AB3 4 VAL F 307  GLU F 308 -1  O  VAL F 307   N  ARG F 295           
SHEET    1 AB4 6 CYS F 280  ILE F 282  0                                        
SHEET    2 AB4 6 ILE F 252  LEU F 256  1  N  LEU F 256   O  VAL F 281           
SHEET    3 AB4 6 SER F 290  ARG F 295 -1  O  ARG F 294   N  ILE F 253           
SHEET    4 AB4 6 THR F 311  ARG F 317 -1  O  LEU F 313   N  VAL F 291           
SHEET    5 AB4 6 ALA F 358  VAL F 364  1  O  VAL F 362   N  LEU F 316           
SHEET    6 AB4 6 GLN F 422  VAL F 426  1  O  GLN F 422   N  LEU F 361           
SHEET    1 AB5 7 GLU G 261  LEU G 262  0                                        
SHEET    2 AB5 7 LEU G 428  ARG G 431 -1  O  LEU G 428   N  LEU G 262           
SHEET    3 AB5 7 SER G 452  THR G 455  1  O  LEU G 453   N  ARG G 429           
SHEET    4 AB5 7 GLU G 325  LYS G 335 -1  N  VAL G 327   O  LEU G 454           
SHEET    5 AB5 7 PHE G 308  GLU G 314 -1  N  TRP G 310   O  LEU G 328           
SHEET    6 AB5 7 TYR G 267  ASP G 274 -1  N  CYS G 272   O  VAL G 309           
SHEET    7 AB5 7 HIS G 298  ARG G 301  1  O  THR G 299   N  VAL G 273           
SHEET    1 AB6 6 GLU G 261  LEU G 262  0                                        
SHEET    2 AB6 6 LEU G 428  ARG G 431 -1  O  LEU G 428   N  LEU G 262           
SHEET    3 AB6 6 SER G 452  THR G 455  1  O  LEU G 453   N  ARG G 429           
SHEET    4 AB6 6 GLU G 325  LYS G 335 -1  N  VAL G 327   O  LEU G 454           
SHEET    5 AB6 6 ARG G 363  VAL G 368  1  O  LEU G 367   N  LYS G 335           
SHEET    6 AB6 6 PHE G 398  ARG G 401  1  O  PHE G 398   N  TYR G 366           
SHEET    1 AB7 4 CYS H 280  ILE H 282  0                                        
SHEET    2 AB7 4 ILE H 252  LEU H 256  1  N  LEU H 256   O  VAL H 281           
SHEET    3 AB7 4 SER H 290  ARG H 295 -1  O  ARG H 294   N  ILE H 253           
SHEET    4 AB7 4 VAL H 307  GLU H 308 -1  O  VAL H 307   N  ARG H 295           
SHEET    1 AB8 6 CYS H 280  ILE H 282  0                                        
SHEET    2 AB8 6 ILE H 252  LEU H 256  1  N  LEU H 256   O  VAL H 281           
SHEET    3 AB8 6 SER H 290  ARG H 295 -1  O  ARG H 294   N  ILE H 253           
SHEET    4 AB8 6 THR H 311  ARG H 317 -1  O  LEU H 313   N  VAL H 291           
SHEET    5 AB8 6 ALA H 358  VAL H 364  1  O  VAL H 362   N  LEU H 316           
SHEET    6 AB8 6 GLN H 422  VAL H 426  1  O  GLN H 422   N  LEU H 361           
CISPEP   1 ASN A  448    PRO A  449          0        -0.38                     
CISPEP   2 LEU A  528    GLN A  529          0        -4.80                     
CISPEP   3 ASN C  448    PRO C  449          0         0.67                     
CISPEP   4 LEU C  528    GLN C  529          0        -3.71                     
CISPEP   5 ASN E  448    PRO E  449          0         0.97                     
CISPEP   6 LEU E  528    GLN E  529          0        -0.65                     
CISPEP   7 ASN G  448    PRO G  449          0         0.81                     
CISPEP   8 LEU G  528    GLN G  529          0        -2.54                     
CRYST1   92.442  250.758  430.240  90.00  90.00  90.00 C 2 2 21     32          
ORIGX1      1.000000  0.000000  0.000000        0.00000                         
ORIGX2      0.000000  1.000000  0.000000        0.00000                         
ORIGX3      0.000000  0.000000  1.000000        0.00000                         
SCALE1      0.010818  0.000000  0.000000        0.00000                         
SCALE2      0.000000  0.003988  0.000000        0.00000                         
SCALE3      0.000000  0.000000  0.002324        0.00000                         
(ATOM LINES ARE NOT SHOWN.)
END                                                                             
DBGET integrated database retrieval system