KEGG   Staphylococcus aureus subsp. aureus JH9 (MRSA/VISA): SaurJH9_R0004
Entry
SaurJH9_R0004     misc_RNA  T00522                                 
Symbol
ffs
Name
(GenBank) SRP RNA; RNA component of signal recognitionparticle
  KO
K01983  SRP RNA
Organism
saj  Staphylococcus aureus subsp. aureus JH9 (MRSA/VISA)
Pathway
saj03060  Protein export
Brite
KEGG Orthology (KO) [BR:saj00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    SaurJH9_R0004 (ffs)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:saj03100]
    SaurJH9_R0004 (ffs)
Non-coding RNAs [BR:saj03100]
 Other RNA
  Signal recognition particle
   SaurJH9_R0004 (ffs)
SSDB
Position
536798..536898
NT seq 101 nt   +upstreamnt  +downstreamnt
atttcggtcctatgcaatatgaacccatgaaccatgtcaggtcctgacggaagcagcatt
aagtggatcatcatatgtgccgtagggtagccgagatttag

DBGET integrated database retrieval system