KEGG   Saccharomyces cerevisiae (budding yeast): snR17a
Entry
snR17a            ncRNA     T00005                                 

Definition
(RefSeq) SNR17A
  KO
K14483  U3 small nucleolar RNA
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03008  Ribosome biogenesis in eukaryotes
sce03013  RNA transport
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09122 Translation
   03013 RNA transport
    snR17a
   03008 Ribosome biogenesis in eukaryotes
    snR17a
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:sce03009]
    snR17a
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    snR17a
Ribosome biogenesis [BR:sce03009]
 Related small nucleolar RNAs
  Box C/D snoRNAs
   SnoRNAs involved in processing reactions
    snR17a
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nucleolar RNA
   snR17a
SSDB
Other DBs
NCBI-GeneID: 9164981
SGD: S000007294
Position
XV:780107..780596
NT seq 490 nt   +upstreamnt  +downstreamnt
gtcgacgtacttcagtatgtaatataccccaaacattttacccacaaaaaaccaggattt
gaaaactatagcatctaaaagtcttaggtactagagttttcatttcggagcaggcttttt
gaaaaatttaattcaaccattgcagcagcttttgactaacacattctacagtaggatcat
ttctataggaatcgtcactctttgactcttcaaaagagccactgaatccaacttggttga
tgagtcccataacctttgtaccccagagtgagaaaccgaaattgaatctaaattagcttg
gtccgcaatccttagcggttcggccatctataattttgaataaaaattttgctttgccgt
tgcatttgtagttttttcctttggaagtaattacaatattttatggcgcgatgatcttga
cccatcctatgtacttcttttttgaagggatagggctctatgggtgggtacaaatggcag
tctgacaagt

KEGG   Saccharomyces cerevisiae (budding yeast): snR17b
Entry
snR17b            ncRNA     T00005                                 

Definition
(RefSeq) SNR17B
  KO
K14483  U3 small nucleolar RNA
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03008  Ribosome biogenesis in eukaryotes
sce03013  RNA transport
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09122 Translation
   03013 RNA transport
    snR17b
   03008 Ribosome biogenesis in eukaryotes
    snR17b
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03009 Ribosome biogenesis [BR:sce03009]
    snR17b
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    snR17b
Ribosome biogenesis [BR:sce03009]
 Related small nucleolar RNAs
  Box C/D snoRNAs
   SnoRNAs involved in processing reactions
    snR17b
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nucleolar RNA
   snR17b
SSDB
Other DBs
NCBI-GeneID: 9164985
SGD: S000007441
Position
XVI:complement(281056..281517)
NT seq 462 nt   +upstreamnt  +downstreamnt
gtcgacgtacttcagtatgttttataccatatactttattaggaatataacaaagcatac
ccaataattaggcaatgcgattgtcgtattcaacaaccatcttctatttcaccagcttca
ggttttgactaacacattcaacagtaggatcatttctataggaatcgtcactctttgact
cttcaaaagagccactgaatccaacttggttgatgagccccataacctttgtaccccaga
gtgaggaaatgaaatcgaatttaaattagcttggtccgcaatccttagcggttcggccat
ctataattttgaataaaattttgctttgccgttgcaattgtgataacttcctttggaatt
tgttgcgatatttaatggcgcgatgatcttgacccatcctatgtgcttccattttggaag
gatagggattcatgggtgggtacaaatggcagtctgacaagt

DBGET integrated database retrieval system