KEGG   Saccharomyces cerevisiae (budding yeast): snR19
Entry
snR19             ncRNA     T00005                                 

Definition
(RefSeq) SNR19
  KO
K14276  U1 spliceosomal RNA
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03013  RNA transport
sce03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    snR19
  09122 Translation
   03013 RNA transport
    snR19
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:sce03041]
    snR19
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    snR19
Spliceosome [BR:sce03041]
 Spliceosomal RNAs
  snR19
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nuclear RNA
   snR19
SSDB
Other DBs
NCBI-GeneID: 9164965
SGD: S000007295
Position
XIV:complement(230105..230672)
NT seq 568 nt   +upstreamnt  +downstreamnt
atacttaccttaagatatcagaggagatcaagaagtcctactgatcaaacatgcgcttcc
aatagtagaaggacgttaagcatttatcattgaactataattgttcattgaagtcattga
tgcaaactccttggtcacacacacatacggcgcggaaggcgtgtttgctgacgtttccat
tcccttgtttcaatcattggttaatcccttgattcctttggggatttttgggttaaactg
atttttggggccctttgtttcttctgcctggagaagtttgacaccaaattcaaattggtg
ttaggggagctggggcctttcaaaagagagctttgtagaggcattctttttgactacttt
tctctagcgtgccattttagtttttgacggcagattcgaatgaacttaagtttatgatga
aggtatggctgttgagattatttggtcgggattgtagtttgaagatgtgctcttttgagc
agtctcaactttgctcgttcccgttatgggaaaaattttggaaggtcttggtaggaacgg
gtggatcttataatttttgatttatttt

DBGET integrated database retrieval system