KEGG   Saccharomyces cerevisiae (budding yeast): snR6
Entry
snR6              ncRNA     T00005                                 

Definition
(RefSeq) SNR6
  KO
K14280  U6 spliceosomal RNA
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03013  RNA transport
sce03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    snR6
  09122 Translation
   03013 RNA transport
    snR6
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:sce03041]
    snR6
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    snR6
Spliceosome [BR:sce03041]
 Spliceosomal RNAs
  snR6
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nuclear RNA
   snR6
SSDB
Other DBs
NCBI-GeneID: 9164922
SGD: S000006494
Position
XII:366235..366346
NT seq 112 nt   +upstreamnt  +downstreamnt
gttcgcgaagtaacccttcgtggacatttggtcaatttgaaacaatacagagatgatcag
cagttcccctgcataaggatgaaccgttttacaaagagatttatttcgtttt

DBGET integrated database retrieval system