KEGG   Saccharomyces cerevisiae (budding yeast): snR7-L
Entry
snR7-L            ncRNA     T00005                                 

Definition
(RefSeq) SNR7-L
  KO
K14279  U5 spliceosomal RNA
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03013  RNA transport
sce03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    snR7-L
  09122 Translation
   03013 RNA transport
    snR7-L
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:sce03041]
    snR7-L
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    snR7-L
Spliceosome [BR:sce03041]
 Spliceosomal RNAs
  snR7-L
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nuclear RNA
   snR7-L
SSDB
Other DBs
NCBI-GeneID: 9164899
SGD: S000006495
Position
VII:complement(939459..939672)
NT seq 214 nt   +upstreamnt  +downstreamnt
aagcagctttacagatcaatggcggagggaggtcaacatcaagaactgtgggccttttat
tgcctatagaacttataacgaacatggttcttgccttttaccagaaccatccgggtgttg
tctccatagaaacaggtaaagctgtccgttactgtgggcttgccatattttttggaactt
ttctgccctttttctcaatgagtaaggagggcgt

KEGG   Saccharomyces cerevisiae (budding yeast): snR7-S
Entry
snR7-S            ncRNA     T00005                                 

Definition
(RefSeq) SNR7-S
  KO
K14279  U5 spliceosomal RNA
Organism
sce  Saccharomyces cerevisiae (budding yeast)
Pathway
sce03013  RNA transport
sce03040  Spliceosome
Brite
KEGG Orthology (KO) [BR:sce00001]
 09120 Genetic Information Processing
  09121 Transcription
   03040 Spliceosome
    snR7-S
  09122 Translation
   03013 RNA transport
    snR7-S
 09180 Brite Hierarchies
  09182 Protein families: genetic information processing
   03041 Spliceosome [BR:sce03041]
    snR7-S
  09184 RNA family
   03100 Non-coding RNAs [BR:sce03100]
    snR7-S
Spliceosome [BR:sce03041]
 Spliceosomal RNAs
  snR7-S
Non-coding RNAs [BR:sce03100]
 Small non-coding RNA
  Small nuclear RNA
   snR7-S
SSDB
Other DBs
NCBI-GeneID: 9164900
SGD: S000006496
Position
VII:complement(939494..939672)
NT seq 179 nt   +upstreamnt  +downstreamnt
aagcagctttacagatcaatggcggagggaggtcaacatcaagaactgtgggccttttat
tgcctatagaacttataacgaacatggttcttgccttttaccagaaccatccgggtgttg
tctccatagaaacaggtaaagctgtccgttactgtgggcttgccatattttttggaact

DBGET integrated database retrieval system