KEGG   Streptomyces avermitilis: SAVERM_m1
Entry
SAVERM_m1         misc_RNA  T00126                                 
Symbol
crn
Name
(GenBank) small cytoplasmic 4.5S RNA
  KO
K01983  SRP RNA
Organism
sma  Streptomyces avermitilis
Pathway
sma03060  Protein export
Brite
KEGG Orthology (KO) [BR:sma00001]
 09120 Genetic Information Processing
  09123 Folding, sorting and degradation
   03060 Protein export
    SAVERM_m1 (crn)
 09180 Brite Hierarchies
  09184 RNA family
   03100 Non-coding RNAs [BR:sma03100]
    SAVERM_m1 (crn)
Non-coding RNAs [BR:sma03100]
 Other RNA
  Signal recognition particle
   SAVERM_m1 (crn)
SSDB
Position
complement(5095065..5095146)
NT seq 82 nt   +upstreamnt  +downstreamnt
ccctcacgtggcgctatctgactgaactcccccagggccggaagtcagcaagggtaggtt
ggctctggcgggtgcgtggggg

DBGET integrated database retrieval system