Streptomyces malaysiensis HNM0141: I1A49_20645 Help Entry I1A49_20645       CDS       T07406                                  Name (GenBank) chorismate mutase   KO K04093   chorismate mutase [EC:5.4.99.5] Organism ssoi  Streptomyces malaysiensis HNM0141 Pathway ssoi00400   Phenylalanine, tyrosine and tryptophan biosynthesis ssoi01100   Metabolic pathways ssoi01110   Biosynthesis of secondary metabolites ssoi01230   Biosynthesis of amino acids Brite KEGG Orthology (KO) [BR:ssoi00001]  09100 Metabolism   09105 Amino acid metabolism    00400 Phenylalanine, tyrosine and tryptophan biosynthesis     I1A49_20645 Enzymes [BR:ssoi01000]  5. Isomerases   5.4  Intramolecular transferases    5.4.99  Transferring other groups     5.4.99.5  chorismate mutase      I1A49_20645 BRITE hierarchy SSDB OrthologParalogGFIT Motif Pfam:  CM_2 TPR_MLP1_2 Motif Other DBs NCBI-ProteinID:  QPI57007 UniProt:  A0ABX6W6C7 Position 5180799..5181068 Genome browser AA seq 89 aa AA seqDB search MSSSSTGAETADVIGAARERIDALDGQILDLVRERMAVSATVQEARIAAGGRRVQLSREM EILDRYRQRLGKPGTTLAMTLLELCRGRV NT seq 270 nt NT seq  +upstreamnt  +downstreamnt atgagcagcagtagtacgggcgcggagaccgcggatgtgatcggcgccgcacgggagcgg atcgacgccctggacgggcagatcctggatctcgtccgggagcggatggcggtgtcggcc accgtccaggaggcgcggatcgcggcgggcgggcggcgggtgcagctctcccgcgagatg gagatcctcgaccgctaccggcagcggctgggcaagccgggtacgacgctcgccatgacg ctgctggagctgtgccggggccgggtctga

All links   Gene (1) NCBI-PROTEINID (1) Protein sequence (1) UniProt (1) Protein domain (2) Pfam (2) All databases (4) Download RDF

DBGET integrated database retrieval system