KEGG   Homo sapiens (human): 10057Help
Entry
10057             CDS       T01001                                 

Gene name
ABCC5, ABC33, EST277145, MOAT-C, MOATC, MRP5, SMRP, pABC11
Definition
ATP-binding cassette, sub-family C (CFTR/MRP), member 5
Orthology
K05668  
ATP-binding cassette, subfamily C (CFTR/MRP), member 5
Organism
hsa  Homo sapiens (human)
Pathway
ABC transporters
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Environmental Information Processing
  Membrane transport
   02010 ABC transporters
    10057 (ABCC5)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
3q27
AA seq 208 aa AA seqDB search
MKDIDIGKEYIIPSPGYRSVRERTSTSGTHRDREDSKFRRTRPLECQDALETAARAEGLS
LDASMHSQLRILDEEHPKGKYHHGLSALKPIRTTSKHQHPVDNAGLFSCMTFSWLSSLAR
VAHKKGELSMEDVWSLSKHESSDVNCRRLERLWQEELNEVGPDAASLRRVVWIFCRTRLI
LSIVCLMITQLAGFSGPNFQDGCILRSE
NT seq 627 nt NT seq  +upstreamnt  +downstreamnt
atgaaggatatcgacataggaaaagagtatatcatccccagtcctgggtatagaagtgtg
agggagagaaccagcacttctgggacgcacagagaccgtgaagattccaagttcaggaga
actcgaccgttggaatgccaagatgccttggaaacagcagcccgagccgagggcctctct
cttgatgcctccatgcattctcagctcagaatcctggatgaggagcatcccaagggaaag
taccatcatggcttgagtgctctgaagcccatccggactacttccaaacaccagcaccca
gtggacaatgctgggcttttttcctgtatgactttttcgtggctttcttctctggcccgt
gtggcccacaagaagggggagctctcaatggaagacgtgtggtctctgtccaagcacgag
tcttctgacgtgaactgcagaagactagagagactgtggcaagaagagctgaatgaagtt
gggccagacgctgcttccctgcgaagggttgtgtggatcttctgccgcaccaggctcatc
ctgtccatcgtgtgcctgatgatcacgcagctggctggcttcagtggaccaaattttcag
gatggctgtattctgcggtcagaatga

DBGET integrated database retrieval system