KEGG   Homo sapiens (human): 1258Help
Entry
1258              CDS       T01001                                 

Gene name
CNGB1, CNCG2, CNCG3L, CNCG4, CNG4, CNGB1B, GAR1, GARP, GARP2, RCNC2, RCNCb, RCNCbeta, RP45
Definition
(RefSeq) cyclic nucleotide gated channel beta 1
  KO
K04952  
cyclic nucleotide gated channel beta 1
Organism
hsa  Homo sapiens (human)
Pathway
cGMP-PKG signaling pathway
cAMP signaling pathway
Olfactory transduction
Phototransduction
Module
cGMP signaling
Disease
H00527  
Retinitis pigmentosa (RP)
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Environmental Information Processing
  Signal transduction
   04024 cAMP signaling pathway
    1258 (CNGB1)
   04022 cGMP - PKG signaling pathway
    1258 (CNGB1)
 Organismal Systems
  Sensory system
   04744 Phototransduction
    1258 (CNGB1)
   04740 Olfactory transduction
    1258 (CNGB1)
Ion channels [BR:hsa04040]
 Related to voltage-gated cation channels
  Cyclic nucleotide-gated channel (CNG)
   1258 (CNGB1)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-ProteinID: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
16q13
AA seq 1251 aa AA seqDB search
MLGWVQRVLPQPPGTPRKTKMQEEEEVEPEPEMEAEVEPEPNPEEAETESESMPPEESFK
EEEVAVADPSPQETKEAALTSTISLRAQGAEISEMNSPSRRVLTWLMKGVEKVIPQPVHS
ITEDPAQILGHGSTGDTGCTDEPNEALEAQDTRPGLRLLLWLEQNLERVLPQPPKSSEVW
RDEPAVATGAASDPAPPGRPQEMGPKLQARETPSLPTPIPLQPKEEPKEAPAPEPQPGSQ
AQTSSLPPTRDPARLVAWVLHRLEMALPQPVLHGKIGEQEPDSPGICDVQTISILPGGQV
EPDLVLEEVEPPWEDAHQDVSTSPQGTEVVPAYEEENKAVEKMPRELSRIEEEKEDEEEE
EEEEEEEEEEEVTEVLLDSCVVSQVGVGQSEEDGTRPQSTSDQKLWEEVGEEAKKEAEEK
AKEEAEEVAEEEAEKEPQDWAETKEEPEAEAEAASSGVPATKQHPEVQVEDTDADSCPLM
AEENPPSTVLPPPSPAKSDTLIVPSSASGTHRKKLPSEDDEAEELKALSPAESPVVAWSD
PTTPKDTDGQDRAASTASTNSAIINDRLQELVKLFKERTEKVKEKLIDPDVTSDEESPKP
SPAKKAPEPAPDTKPAEAEPVEEEHYCDMLCCKFKHRPWKKYQFPQSIDPLTNLMYVLWL
FFVVMAWNWNCWLIPVRWAFPYQTPDNIHHWLLMDYLCDLIYFLDITVFQTRLQFVRGGD
IITDKKDMRNNYLKSRRFKMDLLSLLPLDFLYLKVGVNPLLRLPRCLKYMAFFEFNSRLE
SILSKAYVYRVIRTTAYLLYSLHLNSCLYYWASAYQGLGSTHWVYDGVGNSYIRCYYFAV
KTLITIGGLPDPKTLFEIVFQLLNYFTGVFAFSVMIGQMRDVVGAATAGQTYYRSCMDST
VKYMNFYKIPKSVQNRVKTWYEYTWHSQGMLDESELMVQLPDKMRLDLAIDVNYNIVSKV
ALFQGCDRQMIFDMLKRLRSVVYLPNDYVCKKGEIGREMYIIQAGQVQVLGGPDGKSVLV
TLKAGSVFGEISLLAVGGGNRRTANVVAHGFTNLFILDKKDLNEILVHYPESQKLLRKKA
RRMLRSNNKPKEEKSVLILPPRAGTPKLFNAALAMTGKMGGKGAKGGKLAHLRARLKELA
ALEAAAKQQELVEQAKSSQDVKGEEGSAAPDQHTHPKEAATDPPAPRTPPEPPGSPPSSP
PPASLGRPEGEEEGPAEPEEHSVRICMSPGPEPGEQILSVKMPEEREEKAE
NT seq 3756 nt NT seq  +upstreamnt  +downstreamnt
atgttgggctgggtccagagggtgctgcctcagcccccagggacccctcggaagaccaag
atgcaggaggaagaggaagtggaaccagagccagagatggaggcggaggtggaaccagaa
ccgaatcctgaggaggccgagacagagtccgagtccatgccccccgaagagtcattcaag
gaggaggaagtggctgtggcagacccaagccctcaggagaccaaggaggctgcccttact
tccaccatatccctccgggcccagggcgctgagatttctgaaatgaatagtcccagccgc
agggtactgacctggctcatgaagggcgtagagaaggtgatcccgcagcctgttcacagc
atcacggaggacccggctcagatcctggggcatggcagcactggggacacagggtgcaca
gatgaacccaatgaggcccttgaggcccaagacactaggcctgggctgcggctgcttctg
tggctggagcagaatctggaaagagtgcttcctcagccccccaaatcctctgaggtctgg
agagatgagcctgcagttgctacaggtgctgcctcagacccagcgcctccaggacgcccc
caggaaatggggcccaagctgcaggcccgggagaccccctccctgcccacacccatcccc
ctgcagcccaaggaggaacccaaggaggcaccagctccagagccccagcccggctcccag
gcccagacctcctccctgccaccaaccagggaccctgccaggctggtggcatgggtcctg
cacaggctggagatggccttgccgcagccagtgctacatgggaaaataggggaacaggag
cctgactcccctgggatatgtgatgtgcagaccatcagcatccttcctggaggacaagtg
gagcctgaccttgtcctagaggaggttgaaccgccctgggaggatgcccaccaggatgtc
agtaccagcccacagggtacagaggtggttccagcttatgaagaagagaacaaagctgtg
gagaagatgcccagagagctgtcccggattgaagaggagaaagaagatgaggaggaggaa
gaggaagaggaggaggaggaggaagaggaggaggtgactgaggtgctgctggatagctgt
gtggtgtcgcaggtgggcgtgggccagagtgaagaagacgggacccggccccagagcact
tcagatcagaagctgtgggaggaagttggggaggaggccaagaaggaggctgaagagaag
gccaaggaggaggccgaggaggtggctgaagaggaggctgaaaaggagccccaggactgg
gcggagaccaaggaggagcctgaggctgaggccgaggctgccagttcaggagtgcctgcc
acgaaacagcacccagaagtgcaggtggaagatactgatgctgatagctgccccctcatg
gcagaagagaatccaccctcaaccgtgttgccgccaccgtctcctgccaaatcagacacc
cttatagtcccaagctcagcctcggggacacacaggaagaagctgccctctgaggatgat
gaggctgaagagctcaaggcgttgtcaccagcagagtccccagtggttgcctggtctgac
cccaccaccccgaaggacactgatggccaggaccgtgcggcctccacggccagcacaaat
agcgccatcatcaacgaccggctccaggagctggtgaagctcttcaaggagcggacagag
aaagtgaaggagaaactcattgaccctgacgtcacctctgatgaggagagccccaagccc
tccccagccaagaaagccccagagccagctccagacacaaagcccgctgaagccgagcca
gtggaagaggagcactattgcgacatgctctgctgcaagttcaaacaccgcccctggaag
aagtaccagtttccccagagcattgacccgctgaccaacctgatgtatgtcctatggctg
ttcttcgtggtgatggcctggaattggaactgttggctgattcccgtgcgctgggccttc
ccctaccagaccccggacaacatccaccactggctgctgatggattacctatgcgacctc
atctacttcctggacatcaccgtgttccagacacgcctgcagtttgtcagaggcggggac
atcattacggacaaaaaggacatgcgaaataactacctgaagtctcgccgcttcaagatg
gacctgctcagcctcctgcccttggattttctctatttgaaagtcggtgtgaaccccctc
ctccgcctgccccgctgtttaaagtacatggccttcttcgagtttaacagccgcctggaa
tccatcctcagcaaagcctacgtgtacagggtcatcaggaccacagcctaccttctctac
agcctgcatttgaattcctgtctttattactgggcatcggcctatcagggcctcggctcc
actcactgggtttacgatggcgtgggaaacagttatattcgctgttactactttgctgtg
aagaccctcatcaccatcggggggctgcctgaccccaagacactctttgaaattgtcttc
cagctgctgaattatttcacgggcgtctttgctttctctgtgatgatcggacagatgaga
gatgtggtaggggccgccaccgccggacagacctactaccgcagctgcatggacagcacg
gtgaagtacatgaatttctacaagatccccaagtccgtgcagaaccgcgtcaagacctgg
tacgagtacacctggcactcgcaaggcatgctggatgagtcagagctgatggtgcagctt
ccagacaagatgcggctggacctcgccatcgacgtgaactacaacatcgttagcaaagtc
gcactctttcagggctgtgaccggcagatgatctttgacatgctgaagaggcttcgctct
gttgtctacctgcccaacgactatgtgtgcaagaagggggagatcggccgtgagatgtac
atcatccaggcagggcaagtgcaggtcttgggcggccctgatgggaaatctgtgctggtg
acgctgaaagctggatctgtgtttggagaaataagcttgctggctgttgggggcgggaac
cggcgcacggccaacgtggtggcgcacgggtttaccaacctcttcatcctggataagaag
gacctgaatgagattttggtgcattatcctgagtctcagaagttactccggaagaaagcc
aggcgcatgctgagaagcaacaataagcccaaggaggagaagagcgtgctgatccttcca
ccccgggcgggcaccccaaagctcttcaacgctgccctcgctatgacaggaaagatgggt
ggcaagggggcaaaaggcggcaaacttgctcacctccgggcccggctcaaagaactggcc
gcgctggaggcggctgcaaagcagcaagagttggtggaacaggccaagagctcgcaagac
gtcaagggagaggaaggctccgccgccccagaccagcacacgcacccaaaggaggccgcc
accgacccacccgcgccccggacgccccccgagcccccggggtctccaccgagctctcca
ccgcctgcctcccttgggaggccggagggagaggaggaggggccggccgagcccgaagag
cactcggtgaggatctgcatgagcccgggcccggagccgggagagcagatcctgtcggtg
aagatgccggaggaaagggaggagaaggcggagtaa

DBGET integrated database retrieval system