KEGG   Homo sapiens (human): 27113Help
Entry
27113             CDS       T01001                                 

Gene name
BBC3, JFY-1, JFY1, PUMA
Definition
BCL2 binding component 3
Orthology
K10132  
BCL2-binding component 3
Organism
hsa  Homo sapiens (human)
Pathway
p53 signaling pathway
Hippo signaling pathway
Huntington's disease
Measles
Brite
KEGG Orthology (KO) [BR:hsa00001]
 Environmental Information Processing
  Signal transduction
   04390 Hippo signaling pathway
    27113 (BBC3)
 Cellular Processes
  Cell growth and death
   04115 p53 signaling pathway
    27113 (BBC3)
 Human Diseases
  Neurodegenerative diseases
   05016 Huntington's disease
    27113 (BBC3)
  Infectious diseases
   05162 Measles
    27113 (BBC3)
BRITE hierarchy
SSDB OrthologParalogGFIT
Other DBs
NCBI-GI: 
NCBI-GeneID: 
OMIM: 
HGNC: 
HPRD: 
Ensembl: 
Vega: 
UniProt: 
Position
19q13.3-q13.4
AA seq 261 aa AA seqDB search
MKFGMGSAQACPCQVPRAASTTWVPCQICGPRERHGPRTPGGQLPGARRGPGPRRPAPLP
ARPPGALGSVLRPLRARPGCRPRRPHPAARCLPLRPHRPTRRHRRPGGFPLAWGSPQPAP
RPAPGRSSALALAGGAAPGVARAQRPGGSGGRSHPGGPGSPRGGGTVGPGDRGPAAADGG
RPQRTVRAAETRGAAAAPPLTLEGPVQSHHGTPALTQGPQSPRDGAQLGACTRPVDVRDS
GGRPLPPPDTLASAGDFLCTM
NT seq 786 nt NT seq  +upstreamnt  +downstreamnt
atgaaatttggcatggggtctgcccaggcatgtccatgccaggtgcccagggctgcttcc
acgacgtgggtcccctgccagatttgtggccccagggagcgccatggcccgcgcacgcca
ggagggcagctccccggagcccgtagagggcctggcccgcgacggcccgcgccccttccc
gctcggccgcctggtgccctcggcagtgtcctgcggcctctgcgagcccggcctggctgc
cgcccccgccgcccccaccctgctgcccgctgcctacctctgcgcccccaccgccccacc
cgccgtcaccgccgccctggggggttcccgctggcctgggggtccccgcagccggccccg
aggcccgcgcccggacggtcctcagccctcgctctcgctggcggagcagcacctggagtc
gcccgtgcccagcgccccgggggctctggcgggcggtcccacccaggcggccccgggagt
ccgcggggaggaggaacagtgggcccgggagatcggggcccagctgcggcggatggcgga
cgacctcaacgcacagtacgagcggcggagacaagaggagcagcagcggcaccgcccctc
accctggagggtcctgtacaatctcatcatgggactcctgcccttacccaggggccacag
agcccccgagatggagcccaattaggtgcctgcacccgcccggtggacgtcagggactcg
gggggcaggcccctcccacctcctgacaccctggccagcgcgggggactttctctgcacc
atgtag

DBGET integrated database retrieval system