KEGG   Rattus norvegicus (rat): 500462Help
Entry
500462            misc_RNA  T01003                                 

Gene name
RGD1564956
Definition
similar to calcium binding protein P22
Organism
rno  Rattus norvegicus (rat)
SSDB OrthologParalogGFIT
Other DBs
NCBI-GeneID: 
RGD: 
Position
5q24
NT seq 2433 nt NT seq  +upstreamnt  +downstreamnt
cttgccgccgctgcttctggcgctgccgctcccggaggagctcccgtcacggtgatgggg
tctcgggcctccacgttactgcgggacgaagagctcgaggagatcaagaaggagactggc
ttttcccacagtcagatcacacgcctgtacagccgcttcaccagcctggacaaaggggag
aacggaactctcagccgggaagatttccagaggattccagaacttgccatcaacccactg
ggggaccggatcatcaatgccttcttctcagagggagaggatcaggtaaacttccgagga
ttcatgagaactttggctcatttccgacccattgaggataacgaaaagagcaaagatgtg
aatggactggaacccctcaacagccggagcaacaaactgcactttgctttcagactttat
gacttggataaagatgacaagatctcccgcgatgagctgttacaggtactgcgaatgatg
gtcggagtgaatatctcagatgagcagctgggcagtattgcagacaggaccatccaggag
gctgaccaagatggagacagtgccatatcttttacagaatttgttaaggttttggagaag
gtggatgtagaacagaagatgagcatccgatttcttcactaaagggcagagaccaaatta
ttcttgctttctagtatttaagaactgaaacttccttctgtcctccagccccaccccatc
ctgtcatccccctttccagaatactacagctcctgcatgacaacctgaagtctctcctgt
ccatacaaacttgcctttggtgtataaacagggcgttacagaatggtaccctgtctattt
ctgttcggtatccacccatcagtctttattgtaagtaccaacttcccctgttctactgct
cagtgccacgcatccgtcctgtctgaggaaagaaacagggactcatgtcaagaaccagcc
agcaaagctcccactagatgggaccatatccatgctgccttcccttcatcagccctccat
catggtcctgtgtgctgtgtcctgtgtcctgtgtctgtttcttcctacctctctgtcatc
cagccttctctcctcagtctttcagctgtcctcctgtcgttgagattccctgcattctac
ttgactctgggctctgctggtaagcctgtttctgatgtcgcaggatagttagtggtctgg
tgatctgtatcaaccttctgatgtgggatattgcctatccaggagctattgctctgtcgt
cacagggcttatgagcagacatgttcttaaaaggtagtcatggtgaggcttgtagagcca
tgtctcctaggtggcttcccaggtctctctacctctgactttttattttcaaatatattt
atttggcttttctgggtacagtgttgacattcagaaaatagtctaatgcctgccagtttg
cttctctttgggacattgtcaccacccaagcggctgttctgacaatatggtagagggcct
tcttgtgttttctgacaaggatgggcaccctggagagctgcccacatttgctccacagca
tgggttatgcctcagtgttctgtacacttgaagattcttcacatttccaaacagaaagac
tagtgttacagaagtgcctgacttacctcagtcctaaagaattagattgtcctcagtgtc
ttaaagttttgtacaaaactctgaatgaattttatacttggcaaattttaatgctggaag
atgtatagtcagttcataatcctggtccaggcactgtatacatcgaatgtattgtctcat
gagcttcctaatgacacgaccttcctagctccttgtgaatactatactatgcagatccct
tagaagcatgggacctgggactggtggcaccaactgaggtgacattctctgccaatgtca
gcttgatttagatgtcactgcatcaagctgcttccgccctgtgttcctgtgaatctgctc
ttggctggctttctctggtgttgcctgcttgcttgcttgctttgttgctttggaaggcta
tccaagatatataagcaattctttaggaaataaattgctgttaacccaaacaaacaaaaa
cactgcagatgagatgggtaaaggcaagcagtgggggcgtggctaggacagatggctagg
gtctacatgaactggggaattcttttgaaatatgtcagactttgtgatcaaatgatgtga
tataagaattgtataaagggaataattgtctgatactgatctgtttgagaagtacttcag
aagcatcttgatttaattatttaaagtttctaagattatgcctcccttggctgtatagca
aactgtttttatccacagttgtgccttattgtcccattaaaattgtattcctcaatccac
caataaattaattgtcgttaaaacaaaaaaaaa

DBGET integrated database retrieval system